Über einen Test, mit dem man eine Pandemie herbeizauberte.


Wenn man heutzutage in den Medien von Coronatests spricht, ist im Allgemeinen der sogenannte PCR-Test gemeint. Derzeit wird auch an der Einführung von Antikörper- und Antigentests gearbeitet, aber diese Verfahren waren bis weit in den Herbst 2020 hinein eindeutig in der Minderzahl. Erstaunlicherweise weiß das Gros der Bevölkerung nicht, was der PCR-Test tatsächlich tut — und was er nicht tut. Das ist fatal, denn was er NICHT tut, ist das, was ihm in Politik und Medien fortlaufend angedichtet wird. Der  gefeierte PCR-Test des Christian Drosten weist keine Infektionen und auch nicht das “neuartige Virus” nach.


Wenn gleich das geschickterweise nicht so direkt gesagt wird, so ist doch die Berichterstattung der Meinungsführer ganz klar darauf ausgerichtet, die PCR-Methode als eine zu verstehen, welche Infektionen — unter anderem mit dem “neuartigen Virus” — nachweisen könnte. Unverblümt wird Tag für Tag, Stunde für Stunde die Mär von den “Neuinfektionen” verbreitet. Auf diese Art und Weise verbreitet man Angst und Hysterie, um als Preis zur vermeintlichen schnellen Rettung vor dem Virus eine Fülle politischer Entscheidungen zu akzeptieren, die noch vor Monaten undenkbar, ja schlicht nicht umsetzbar gewesen wären.

Es muss bei der Betrachtung dessen, für was die PCR-Methode taugt und für was sie das nicht tut — so auch wie deren Ergebnisse für wirtschaftliche, politische und letztlich ideologische Zwecke benutzt werden — nicht die Frage nach der Existenz des “neuartigen Virus” gestellt werden. Wenn wir über die grundlegende Funktion des Tests Bescheid wissen, wird uns auch klar, warum dem so ist.

Das ist von fundamentaler Bedeutung für alles, was um die im März des Jahres 2020 ausgerufene Pandemie geschehen ist. Denn wenn wir genau hinschauen, ist allein der PCR-Test die Grundlage, auf dem die “Coronavirus-Pandemie” aufbaut. Dabei sind nicht die Ergebnisse des Tests das Problem — der Test funktioniert sehr wohl zuverlässig —, sondern die Art und Weise ihrer Herbeiführung wie Interpretation.

Vom SARS-CoV-2 — Virus

Der Steckbrief zum “neuartigen Virus” (a1) wurde am 29. Januar 2020 von chinesischen Forschern im Wissenschaftsportal Lancet veröffentlicht. Grundlage waren die Proben von neun an den Atemwegen erkrankten Chinesen. Acht davon hatten zuvor den inzwischen allbekannten Meeresfrüchtemarkt von Huanan in der chinesischen Metropole Wuhan besucht (1).

Was dem Autor beim Studium des Lancet-Berichts auffiel, ist die Tatsache, dass zwar von Isolaten gesprochen wird, von der vollständigen Isolierung eines Virus jedoch keine Rede sein kann. Dies widerspricht allerdings dem Kochschen Postulat für den zweifelsfreien Nachweis eines Erregers, samt seiner vorgeblich krankmachenden Eigenschaften — dazu gleich noch mehr.

Auch wurde dieser Bericht publiziert, NACHDEM der an der Berliner Charité wirkende Christian Drosten “seinen” PCR-Test für das “neuartige Virus” bereits am 16. Januar veröffentlicht hatte. Es ist keinesfalls transparent, woher das Team von Drosten im Vorab die Daten für das Virus bezog, um daraus in Rekordgeschwindigkeit einen Test zu kreieren. Proben mit einem vollständigen Virus-Isolat standen ihm jedenfalls nicht zur Verfügung (2).

Die Herangehensweise zur angeblichen Entdeckung des SARS-CoV-2 — Virus war vom Grundsatz her die Gleiche, wie sie jetzt beim “Nachweis des Virus” mittels PCR-Test zu sehen ist.

In einem ersten Schritt züchteten die chinesischen Wissenschaftler sogenannte Isolate aus den Proben der Patienten (3). Dieses Züchten ist ein Thema für sich, denn so klar ist es nicht, was die chemischen und biochemischen Substanzen (unter anderem Antibiotika), die man in die Proben einbringt, tatsächlich bewirken.

Mittels sogenannter Transkription und Amplifizierung der Isolate (a1) wurde das aus dem “Isolat” entnommene Erbmaterial durch Teilung vermehrt. Transkription beschreibt die Überführung der einstrangigen und somit nicht eigenständig reproduktionsfähigen RNS (Ribonukleinsäure) in die Aufspaltung einer doppelstrangigen DNS (Desoxyribonukleinsäure), jener DNS, die als Erbinformation in unseren Zellkernen abgelegt ist (4). Amplifikation meint die zyklisch vorgenommene Vermehrung (Kopieren) von RNS mittels Einbindung in die DNS (5, a2).

Von einer auch nur annähernd den Kochschen Postulaten gerecht werdenden vollständigen Isolation des “neuartigen Virus” kann jedoch keine Rede sein. Die chinesischen Wissenschaftler schrieben in ihrer Veröffentlichung (alle Hervorhebungen in den Zitaten durch Autor, a3):

“Von diesen [neun] Personen erhielten wir vollständige und teilweise 2019-nCoV-Genomsequenzen. Die Viruskontigstellen wurden mittels Sanger-Sequenzierung miteinander verbunden, um die Genome in voller Länge zu erhalten, wobei die terminalen Regionen durch schnelle Amplifikation der cDNA-Enden bestimmt wurden.” (1i)

Die Sanger-Sequenzierung ist eine technische Methode zur gerade erwähnten Aufspaltung von DNS, um an einen der nun “offenen” DNS-Stränge bestimmte RNS koppeln zu können (6). Die Sequenzierung von RNS-Sequenzen ist nicht das Gleiche wie die Sequenzierung eines vollständig isolierten Virus. Und tatsächlich findet der Forschende reichlich Informationen zur Sequenzierung in Bezug auf SARS-CoV-2, nie aber auf das Virus als Ganzes (7):

“Die zehn Genomsequenzen von 2019-nCoV, die von den neun Patienten erhalten wurden, waren äußerst ähnlich und wiesen eine Sequenzidentität von mehr als 99-98% auf.” (1ii)

Wie hat man dann aber das Virus entdeckt, so doch eine vollständige Isolierung zwar behauptet, dies aber nirgends nach wissenschaftlichen Kriterien dokumentiert ist?

Man hat die in den Patienten gefundenen Sequenzen um fehlende “Bausteine” ergänzt und zusammengefügt. SARS-CoV-2 wurde — wie andere Viren auch (8) — unter Verwendung komplexer mathematischer Algorithmen in Computer-Software modelliert. Es wurde aus vollständigen Gensequenzen wie auch Genfragmenten konstruiert, nicht einmal rekonstruiert — aber nicht nur das. Denn tatsächlich hat man offensichtlich sogar “passenden”, genetischen Code “erfunden” oder in Datenbanken “gefunden”, um ein vollständiges Modell des Virus zu erhalten. Die Virologen nennen dieses Software-gestützte Verfahren Alignment (9) und behaupten, dass sich die Ausrichtung/Zuordnung — so die deutsche Entsprechung von Alignment — an eine Vorlage in Form eines real existierenden, vollständig isolierten Virus hält.

“Sequence alignment of 2019-nCoV with reference sequences was done with Mafft software (version 7.450).” (10)

Die chinesischen Forscher, welche die Proben der Patienten aus Wuhan untersuchten und vorgaben, dabei das Virus isoliert zu haben, lassen uns in deren Abhandlung wissen:

“Die [als sogenanntes “Isolat”] extrahierte RNA wurde als Vorlage zum Klonen und Sequenzieren des Genoms verwendet. […] Die Sequenz-Reads wurden mit Hilfe der CLC Genomics Software, Version 4.6.1 (CLC Bio), zu Contig-Maps (ein Satz überlappender DNA-Segmente) assembliert.” (3i)

Man verglich mit Vorhandenem, aber nicht mit Viren sondern DNS aus Datenbanken und setzte es dann zusammen (Assemblierung). Wurden die als Vorlage verwendeten Sequenz-Codierungen auf die gleiche Art und Weise erstellt? Wir wissen es nicht. Weiter lesen wir:

“Anschließend wurden spezifische Primer für die PCR entworfen und 5′- oder 3′-RACE (rapid amplification of cDNA ends) verwendet, um Genomlücken aus der konventionellen Sanger-Sequenzierung zu schließen. Diese PCR-Produkte wurden von Gelen aufgereinigt und mit einem BigDye Terminator v3.1 Cycle Sequencing Kit und einem 3130XL Genetic Analyzer gemäß den Anweisungen der Hersteller sequenziert.” (3ii)

Erst durch diese Primer (dazu weiter unten mehr) wurden die verschiedenen Gensequenzen, welche man dem Virus zuschreibt, miteinander verbunden und die – im wahrsten Sinne des Wortes – Konstruktion des Virus vollendet. Dies kann man nicht einfach mit der Entdeckung eines neuartigen Virus gleichsetzen.

Es sollte klar sein, dass die Konstruktion, das Modell eines Virus etwas fundamental anderes beschreibt, als dessen Erkennung als Ganzes, als dessen jederzeit reproduzierbares Isolat. Das Virus, so es dieses gibt, ist groß genug, um jederzeit und ohne weiteres aus menschlichen Abstrichen sichtbar gemacht zu werden. Davon ist dem Autor bis heute nichts bekannt. Vereinfacht stellt sich die Konstruktion des Virus wie im folgenden Bild zu sehen dar (b1):

30 kb steht für 30.000 Basen (Nukleotide). Laut dem Modell gehört das SARS-CoV-2 — Virus, als Mitglied der Familie der Coronaviren mit seinen fast 30.000 aneinandergereihten Nukleotiden zu den größten (längsten) Viren. Da es in RNS gebunden ist, besteht es aus nur einem, gewundenen Einzelstrang (Helix), im Gegensatz zur Doppelhelix bei DNS (11).

Was wir hier erkennen, sind — neben nicht weiter spezifizierter RNS — mehrere, dem SARS-CoV-2 — Virus als charakteristisch zugeschriebene, spezielle Proteine: das RdRP-Gen, das S-, M-, N- und das E-Gen. Dieses (obige) Bild werden wir uns im Verlauf dieser Abhandlung nochmals zu Gemüte führen. Weil es sehr schön auf den täglichen, massenmedialen Betrug hinweist, nachdem mit der PCR-Methode angeblich auf ein Virus getestet würde — was es nicht tut (b1i).

Bedenken wir: Nicht nur ist die obige Abbildung modellhaft, sondern sie bezieht sich auch auf ein Modell, eine Abstraktion, eine Annahme, aber keinesfalls auf eine als Ganzes, als vollständiges Isolat mit der dort nachgewiesenen Struktur des Virus. Auch wenn renommierte Fachzeitschriften wie The Lancet in diversen Publikationen den Eindruck erwecken, dass nachweislich SARS-Viren isoliert worden wären, ist zu sagen: Dem ist nicht so, auch nicht beim SARS-Virus, das als Vorlage für die Modellierung des “neuartigen Virus” genutzt wurde (12, 13).

Als chinesische Forscher am 24. Januar 2020 ihre Untersuchungsergebnisse zu Patienten, die vorgeblich am SARS-CoV-2 — Virus erkrankt waren, veröffentlichten, waren sie ehrlich genug, darauf hinzuweisen:

“Da wir keine Tests zum Nachweis infektiöser Viren im Blut durchgeführt haben, haben wir den Begriff Virämie vermieden und stattdessen RNAämie verwendet. RNAämie wurde als ein positives Ergebnis für die Real-Time RT-PCR in der Plasmaprobe definiert.” (14)

Indirekt haben die Forscher damit auch klar gemacht, dass ein PCR-Test keine isolierten Viren nachweist. Tatsächlich und nachgewiesenermaßen real sind freilich die Gensequenzen, welche man dem Virus zuspricht (a3), und auf eben solche zielt auch die PCR-Methode, mit der wir uns nun befassen.

Der PCR-Test

Das PCR-Testverfahren beschreibt im Grunde eine ganze Reihe sich im Detail unterscheidender Technologien, welche aber alle als zentrale Methode den natürlichen Prozess der Polymerase-Kettenreaktion (aus dem Englischen: Polymerase Chain Reaction, daher kurz PCR) beinhalten. Für den Nachweis bestimmter Gensequenzen, die dem SARS-CoV-2 – Virus zugeschrieben werden, kommt die RT-PCR – Methode zur Anwendung. Das hat insbesondere damit zu tun, dass es sich beim zu detektierenden Material nicht um DNS sondern RNS handelt. Die Methode gliedert sich grundsätzlich in drei Prozesse:

  1. Extraktion (Reinigung, “Isolation”) des Materials aus der Probe
  2. Transkription (Überführung, Umschreiben, Enzymierung) der RNS der Gensequenz in cDNS
  3. Amplifizierung (Vermehrung) der cDNS/DNS (15, 16)

Was geschieht dabei nun im Einzelnen?

Extraktion

Man sollte annehmen, dass ein Erreger aus einer Patientenprobe (Blut, Speichel, Gewebepartikel) mittels geeigneter Verfahren direkt isoliert wird, um ihn nachzuweisen. Isoliert meint hier, dass er als mikrobiologisches Objekt vollständig und eindeutig abgrenzbar von seinem Milieu und umgebenden wie interagierenden Mikroben erfasst wurde. Davon kann bei der vermeintlichen Extraktion des SARS-CoV-2 – Virus — die irritierender Weise aber auch als Isolation bezeichnet wird — keine Rede sein.

Die sogenannte Isolation des “neuartigen Virus” geschieht außerhalb des menschlichen Körpers, in dem die Probe in vitro (in einem Reagens) auf aggressive Art und Weise chemisch und biochemisch bearbeitet wird. Dieser Vorgang wird auch als Reinigung bezeichnet. Die im Ergebnis diesem Cocktail entnommene Substanz bringt aber nun eben auch keine (isolierten) Viren ans Licht — und das behaupten die Virologen interessanterweise auch nicht. Das Extrakt gewinnt man:

“[d]urch Vergiftung mit zelltoxischen Antibiotika, durch extremes Verhungern mittels Entzug der Nährlösung und durch Zugabe von verwesenden, also sich zersetzenden und dabei giftigen Stoffwechselprodukte freisetzenden Eiweißen.” (17)

Den Proben setzt man Substanzen wie zum Beispiel Triphosphat, Magnesiumsulfat, Isopropanol, Kohlendioxid, Chloroform, Serum aus Rinderföten und desweiteren Antibiotika wie Penicillin und Streptomyzin zu, während diese wiederholt zentrifugiert und mit starken Temperaturschwankungen bis hin zum Gefrierpunkt gestresst werden (18 bis 20). Wie bereits weiter oben erwähnt, ist dieses “Isolieren” adäquat zum Verfahren, dass die chinesischen Wissenschaftler bei ihrer “Entdeckung” des Virus benutzten:

“Proben der bronchialen Lungenflüssigkeit wurden in sterilen Behältern gesammelt, denen Virustransportmedium [chemische — und biochemische Substanzen, Antibiotika] hinzugefügt wurde. Die Proben wurden dann zentrifugiert, um Zelltrümmer zu entfernen. Der Überstand wurde auf humane Epithelzellen der Atemwege beimpft, die aus Atemwegsproben von Patienten gewonnen wurden, die sich einer Operation wegen Lungenkrebs unterzogen hatten […].” (3i)

Da wird also eine organische Substanz extrem gestresst, abgetötet und zertrümmert — und dann bezeichnet man das vom Reagensboden entnommene Refugium als Isolat? Woher um alles in der Welt nimmt man die Gewissheit, dass da Viren drin sind und dass diese die Tortur überlebt hätten? Ersetzt hier Gewissheit echtes Wissen?

Wenn das, was bei der Extraktion geschieht, die Isolation von Viren ermöglichte: Wozu benötigt man dann noch die weiter unten beschriebene Polymerase-Kettenreaktion? Der Laie meint: Die Elektronenmikroskopie müsste in der Lage sein, in einem solchen Extrakt Viren zweifelsfrei — also ohne die Gefahr einer Verwechslung mit anderen Mikroben — aufzunehmen. Das ist ganz offensichtlich nicht der Fall. Die Extraktion liefert einen Friedhof zertrümmerter Mikroben — und diese Trümmer sind natürlich nachweisbar, nämlich als relativ kurze Fragmente von DNS und RNS.

Es ist nämlich so, dass die PCR-Methode mittels der Sanger-Sequenzierung bis zu 3.000 Nukleotide lange Gensequenzen nachzuweisen in der Lage ist (21). Durch Einsatz spezieller Polymerasen-Gemische, sowie weiterer Zusätze in der PCR lassen sich sogar Sequenzen von über 20.000 Basenpaaren vervielfältigen (15i).

Jedoch: Auch wenn die Methode extrem sensitiv arbeitet und fast aus dem Nichts Gene vervielfältigen (amplifizieren) kann, so ist doch das “fast” wichtig. Eine Winzigkeit vom Gesuchten muss schon vorliegen. Dass allerdings aus einem wie in oben beschriebener Art und Weise gewonnenen Extrakt ein komplettes, aktives Gen nunmehr per PCR sequenziert und “isoliert” werden kann, ist für den Autor mehr als fraglich.

Aber Fragmente lassen sich sehr wohl transkribieren und amplifizieren (überführen und vermehren, siehe weiter unten). Fragmente, Trümmer von Mikroben, sind — wie das bei Trümmern nun einmal so ist — sehr klein. In RNS beziehungsweise DNS übersetzt heißt es, dass die Gensequenzen sehr, sehr kurz sind.

Je kürzer die gesuchte Gensequenz und je höher die Anzahl der Zyklen bei der Amplifizierung (Vermehrung), desto größer ist auch die Wahrscheinlichkeit, fündig zu werden. Und darum ging es auch, als der PCR-Test für medizinische Zwecke entdeckt wurde: nämlich etwas Bekanntes auf jeden Fall zu finden (a4). Je kürzer und simpler jedoch die Struktur, desto höher ist auch die Chance, sie rein nach dem Zufallsprinzip aufzuspüren. Einfach deshalb, weil diese mit abnehmender Länge immer beliebiger wird.

Aber auf die knapp 30.000 Nukleotide, die man SARS-CoV-2 zuschreibt (22, 23), ist der Test von seiner gesamten Konzeption her überhaupt nicht angelegt. Schon daher ist es mindestens eine hochgradig schlampige Aussage, dass der Test Viren erkennen würde.

Dass der Test statt eines vollständigen Genoms nur Teile dessen, RNS-Sequenzen sucht, ist es aber nicht allein. Denn die RNS, die er sucht, ist — entsprechend seinem Ansatz, sicher fündig auf etwas Vermutetes zu werden — auch noch extrem kurz. Wie die RNS aufgespürt wird, wollen wir uns im Weiteren anschauen.

Reverse Transkription

Das im Zuge von SARS-CoV-2 angewandte Verfahren koppelt die PCR (Polymerase-Kettenreaktion) mit einem zweiten Verfahren, das — so wie das erste — natürlichen Prozessen der Vermehrung von Erbsubstanz entlehnt ist. Damit sprechen wir von einer sogenannten RT-qPCR (a5), bei der das Enzym Transkriptease eine Schlüsselrolle spielt. Die reverse Transkription (Reverse-Transkriptase oder RT) ist notwendig, weil die einstrangige RNS des gesuchten Gens (oder einer Sequenz desselben) sich nicht teilen kann, so wie eine Doppelstrang-DNS. Die RNS kann aber an DNS-Stränge “andocken”, wenn wiederum diese geteilt werden (b2):

Grundbausteine der DNS sind Nukleotide, bestehend aus Phosphatresten, einem Zucker, der Desoxyribose (beide in der Abbildung nicht enthalten), sowie Paaren von jeweils zweien von vier Nukleinbasen. Was wir in Abbildung 2 sehen, ist die Doppelstrang-Helix einer DNS, die sich geteilt hat und an der nun wieder freie Nukleinbasen anlagern, zum Beispiel auch aus RNS. Die vier Nukleinbasen können sein: Adenin (A), Thymin (T), Guanin (G) und Cytosin (C). Die Kombination dieser Basen bildet die genetische Information des Trägers ab.

Die biochemischen Charakteristika der Nukleinbasen lassen im Allgemeinen nur bestimmte Anbindungen freier Basen an einen “geöffneten” DNS-Strang zu. So verbindet sich Adenin stets mit Thymin und Guanin mit Cytosin. An welchen speziellen Abschnitten diese Anbindungen ihren Anfang nehmen, dafür sorgen die Primer, sehr kurze, charakteristische Nukleotide (24).

Wenn man also Gensequenzen mittels PCR und RT finden möchte, ist es notwendig, dass die DNS ein ganz bestimmtes Design aufweist, das komplementär zur gesuchten RNA ist. Das heißt, dass sich die DNS-Stränge durch eine ganz bestimmte Abfolge von Basenpaaren auszeichnen müssen. Basenpaare, die so angeordnet sind, dass RNS eben auch an diese anbinden kann. Es ist wie mit einem Schlüssel, der halt nur in das “richtige” Schloss passt.

Der als Goldstandard gepriesene PCR-Test aus der Berliner Charité schaut im Suchtest nach dem E-Gen, genauer nach der 76 Basen langen E2-Gensequenz (25, a6), welche folgende Abfolge von Basen aufweist:

  • ACAGGTACGTTAATAGTTAATAGCGT
  • ACACTAGCCATCCTTACTGCGCTTCG
  • ATTGTGTGCGTACTGCTGCAATAT (26)

Um an “passende” DNS-Stränge anbinden zu können, sorgt das Enzym der Transkriptease zuvor für ein Umschreiben. Eine der vier Nukleinbasen von RNS, Uracil (U), das in DNS nicht vorkommt, wird dabei durch die Transkriptease in Thymin (T) umgewandelt.

Damit kann die so umgeschriebene Sequenz nun an eine komplementäre Sequenz einer aufgespaltenen DNS anbinden. Weil Adenin stets mit Thymin und Guanin mit Cytosin bindet, stellt sich der Autor den DNS-Komplementärstrang, an dem die zuvor umgeschriebene RNS andocken kann, also folgendermaßen vor:

  • TGTCCATGCAATTATCAATTATCGCA
  • TGTGATCGGTGGAATGACGCGAAGC
  • TAACACACGCATGACGACTTATA

Deshalb nennt man die so gebildete, neue Doppelhelix auch cDNA (complementary DNA), also komplementäre DNS (27). Mittels sogenannter Ribonukleasen und DNS-Polymerase — die hier nicht weiter behandelt werden — erfolgt danach die Synthese des zum gerade gebildeten cDNA-Stranges komplementären DNS-Stranges (28). An dieser Stelle sei nun eine weiter oben bereits angezeigte Grafik nochmals präsentiert (b1ii):

Was fällt auf?

Die Sequenz SARS-Cov2_IBS_E2 ist so ziemlich die Kürzeste, im gesamten Konstrukt des SARS-CoV-2 – Virus. Sie gerät aufgrund eben dieser Kürze in die Nähe von Beliebigkeit und eine exklusive Zuordnung zum Virus — so es ihn tatsächlich gibt — darf schwer in Frage gestellt werden. Ein Genfragment dieser Kürze wird aber seit Monaten als angeblicher Infektions-, ja gar als Erkrankungsnachweis mit COVID-19 deklariert.

Das ist einfach unglaublich. Nochmals: 76 “passende” Basenpaare im Ergebnis der Amplifikation (siehe weiter unten) sind ausreichend genug, um Gesunde zu Kranken zu stempeln, Menschen ihrer Freiheitsrechte zu berauben und ein ganzes Land in Panik zu versetzen.

Die Extraktion des Materials, welches für die RT-PCR verwendet wird, ist schon fragwürdig genug. Dass es sich nun auch noch um eine Minisequenz handelt, die als Pandemienachweis verwendet wird, setzt dem noch eins drauf. Das sehr kurze E-Gen wird als Charakteristikum allen Coronaviren zugeschrieben. Damit ist dieser Suchtest mit der PCR-Methode hoch sensitiv und muss zwingend über mindestens einen, besser zwei oder drei Spezifitätstests abgesichert werden. Diese Tests weisen dann weitere, dem Virus zugeschriebene Gene nach — oder auch nicht. Trifft letzteres zu, lässt sich die Annahme, dass Teile des Virus im Material nachweisbar wären, nicht mehr aufrecht erhalten. Und genau das wird in Deutschland offenbar flächendeckend unterlassen.

Gern weist man in der (noch) meinungsbildenden Politik- und Medienszene darauf hin, dass China das Virus erfolgreich bekämpfen konnte, weil es so drakonische Maßnahmen im Rahmen der nichtpharmazeutischen Intervention durchgesetzt hätte. Aber könnte es möglicherweise auch sein, dass in diesem Land konsequent mehrere Spezifitätstests auf andere Corona-Gensequenzen gefahren werden und allein dadurch eine besondere epidemiologische Situation — die es eh nur in Wuhan zu beobachten gab — beendet beziehungsweise vermieden wurde? Die Frage muss offen bleiben.

Sensitivität und Spezifität

Womit wir zur nächsten Ungereimtheit bei der Anwendung des PCR-Tests in Bezug auf das “neuartige Virus” kommen. Erinnern wir uns dafür an die vorher erläuterte reverse Transkriptease (reverse Transkription), das Umschreiben und Anbauen der RNS-Sequenz auf einen freien DNS-Strang. Der Drosten-Test sieht im Grunde vor, dass Spezifitätstests durchzuführen sind, und zwar auf das RdRP-Gen. Auch dieses Gen ist sehr kurz, bestehend aus gerade einmal 100 Basen, und das — es sei wiederholt — bei einem Virus, das 30.000 Basen lang sein soll. Doch gilt es, einen weiteren, wichtigen Aspekt zu beachten.

Es spielt nämlich auch eine Rolle, wie hoch die Konzentration der Lösung ist, in welcher sich die Polymerase-Kettenreaktion abspielt beziehungsweise abspielen soll. Es dürfte einleuchten, dass, wenn ich einer extrem kurzen Gensequenz extrem viele Komplementärstränge zum Anbinden, anbiete, dass sich dann die Wahrscheinlichkeit deutlich erhöht, dass dies dann auch tatsächlich geschieht. Ein Primer, welcher den Start- und Endpunkt für den Prozess des Umschreibens von RNS auf einen DNS-Strang definiert, ist nochmal erheblich kürzer, als die umzuschreibende Gensequenz selbst, nämlich gerade 15 bis 25 Basen lang.

Was den von der WHO als Goldstandard, ja gar als “diagnostischen Leitfaden” (29) ausgerufenen Drosten-PCR-Test betrifft, fällt auf: Ausgerechnet beim Primer für das RdRP-Gen, mittels dem der Suchtest auf das E2-Gen falsifiziert werden soll, ist die Primerkonzentration auffallend hoch. Wenn man im Netz zu diversen PCR-Verfahren recherchiert, findet man heraus, dass bestimmte Primer-Konzentrationen in der Reaktionslösung eingehalten werden, und zwar zwischen 100 und 400 nM (nmol/l). Beim Test aus dem Hause der Charité wird dieser Wert deutlich überschritten — und zwar nicht nur für das RdRP- sondern auch für das N-Gen, das ebenfalls für Kontrolltests genutzt wird (Zeile 1 und 4 im ersten Abschnitt “RdRP gene”, a7, b3):

Noch etwas findet der aufmerksame Leser, wenn er sich das in der Tabelle definierte Primer-Design anschaut. Da an beide Stränge der aufgespaltenen DNS angebunden wird, gibt es also zwei Primer, einen Forward Primer für den ersten DNS-Strang und einen Reverse Primer für den Zweiten (30, Hervorhebungen durch Autor):

  • GTGARATGGTCATGTGTGGCGG (RdRp_SARSr_F)
  • CARATGTTAAASACACTATTAGCATA (RdRp_SARSr_R)

Wir wissen, dass genetische Informationen in den Nukleinbasen Adenin (A), Thymin (T), Guanin (G), Cytosin (C) und Uracil (U) kodiert werden. Uracil wird bei Transkription der RNS in Thymin umgeschrieben. Die obigen Primer enthalten aber jeweils einen Ausdruck ‘R’. Was bedeutet dieser?

In einer Fußnote steht dazu lapidar: “R is G/A”. Was so viel bedeutet wie: R ist entweder Guanin oder Adenin. Beide Primer können also jeweils in zwei verschiedenen Varianten an DNS binden und das, obwohl Primer bereits extrem kurz sind (19i, 31). Man nennt so etwas degenerierte Primer und tatsächlich ist es so, dass man in diesem Falle nicht weiß, wie der Primer — falls es ihn natürlicherweise gibt — wirklich aussieht (30i). Also hilft man nach, erschafft Konstrukte, modelliert degenerierte Primer am Computer (31, 32). Damit kann so ein Primer auch an Mutationen anbinden, was die Gefahr verfälschter Ergebnisse einschließt.

Einschub: Unter anderem auf solche Ungereimtheiten sind eine ganze Reihe von Wissenschaftlern aufmerksam geworden und fordern daher von Eurosurveillance — dem Herausgeber der Publikation — die Rücknahme des Drosten-Papieres als dem eines den Prüfkriterien für wissenschaftliche Arbeiten nicht erfolgreich bestandenen Dokumentes (33 bis 36).

Interessanterweise liefern andere Staaten Primer für das RdRP-Gen, die ohne die oben beschriebenen “Platzhalter” auskommen, China zum Beispiel (37). Doch gehen wir weiter: Die Testprobe muss thermisch behandelt werden, bevor der Primer an den DNS-Strang ankoppeln kann.

Um die Teilung der DNS anzustoßen beziehungsweise zu beschleunigen, wird als Katalysator Wärme eingesetzt. Dabei werden die Proben in sogenannten Thermocyclern auf über 90 Grad Celsius erhitzt, was zur Aufspaltung (Denaturierung auch Schmelzen, im Englischen melting bezeichnet) der DNS führt. Im nachfolgenden Abkühlungsvorgang auf etwa 55 bis 65 °C (Renaturierung) können nun Startersequenzen, die Primer (Primerhybridisierung oder primer annealing) an den DNS-Strang anbinden.

Wählt man allerdings die Temperatur für diesen Prozess zu nah an oder gar unter den minimalen Grenzwert von 55 °C, dann kann das zu Fehlern, zu Mutationen führen. Primer könnten sich an eben nicht vollständig komplementäre Sequenzen auf dem DNS-Strang anlagern (38). Es ist zumindest eine Anmerkung wert, dass der PCR-Test aus dem Drosten-Team sich genau an diesem Grenzwert bewegt:

Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.” (19iii)

Die Kombination degenerierter Primer (siehe weiter oben) mit solchen Grenzwerten birgt die Gefahr, dass der Test fehlerhaft arbeitet — so die Ansicht des Autors.

Auf jeden Fall binden nach den Primern nunmehr die “passenden” RNS-Sequenzen an die offen liegenden DNS-Stränge (39, 40).

Amplifizierung und Ct-Wert

Im folgenden wird ein Prozess gefahren, der die gewonnene cDNA — die komplementäre, mit den Primern und der transkribierten RNA “bestückten” DNS — zu vervielfältigen versucht. Ein aussagefähiges Ergebnis hängt unter anderem von zwei Parametern ab:

  • der Menge von cDNA (komplementärer DNS), die mittels Reverse Transkriptease gewonnen wurde,
  • der Anzahl von Zyklen die man nun fährt, um das Material mittels Polymerase zu vervielfältigen.

Die Amplifikation der cDNA — auch Vermehrung, Polymerisation oder Elongation genannt — wird also in Zyklen wiederholt. Nach einer bestimmten Anzahl von Zyklen — angezeigt als threshold cycle oder kurz Ct-Wert (41) — kann über geeignete Sonden (42) der Nachweis der gesuchten Gensequenz erbracht werden, weil diese nun in ausreichender Menge vorhanden ist. Das heißt nicht, dass beliebig viele Zyklen gefahren werden, bis man irgendein Positivergebnis findet — warum?

Wenn es um die angebliche Verbreitung des Coronavirus geht, ist regelmäßig von exponentieller Ausbreitung die Rede. Bewiesen wurde das nie. Konnte und kann es auch nicht, da ja bis zum heutigen Tage keine Ergebnisse von Baseline-Studien vorliegen, welche genau das liefern würden.

Bei der Polymerase hingegen ist die exponentielle Vermehrung real und gewollt, und da die Basis den Wert zwei hat — was einer Verdoppelung im Intervall gleichkommt —, bedeutet dies, das in wenigen Dutzend Zyklen gigantische Quoten von amplifizierter cDNA erreicht werden können. Wie lässt sich das besser verbildlichen? Stellen wir uns dafür das folgende vor:

Nehmen wir an, dass im Abstrich eines Menschen zehn RNA-Sequenzen des E2-Gens vorhanden sind (was nichts darüber aussagt, ob da auch zehn “neuartige Coronaviren” sind). Das ist verschwindend wenig und mit Sicherheit völlig irrelevant für den betroffenen Organismus. Stellen wir uns im weiteren vor, dass von diesen zehn Minisequenzen eine die Tortur der Extraktion — der angeblichen Reinigung der Probe — überstanden hat. Vielleicht hat es sich aber auch im Material zufällig, zum Beispiel durch Mutationen gebildet, wer weiß das schon. Gehen wir jetzt davon aus, dass diese RNA mittels Reverse Transkriptase (RT) an DNS andocken konnte und die gewonnene cDNA auf ihre Vervielfältigung wartet. Dann sind wir nach einem Zyklus bei zwei, nach zwei Zyklen bei vier und nach zehn Zyklen bei 1024 durch Amplifikation gewonnenen Sequenzen, die uns das E2-Gen sichtbar machen könnten.

Das ist noch überschaubar. Aber wie sieht es nach 24 Zyklen aus? Dann sind wir bereits bei über 16 Millionen Treffern (16.777.216). Dieser Wert wurde aus einem einzigen Exemplar erfolgreicher RT gewonnen und hier wird auch klar, warum nach dieser Anzahl von Zyklen eine Weiterführung nicht mehr sinnvoll ist. Weil nun aus möglicherweise zufällig angefallenen, winzigen Genfragmenten gigantische Zahlen produziert werden können. Eine Aussage, welche die Kontamination der Probe im Hinblick auf das Vorhandensein oder gar die Menge des gesuchten Materials anzeigt, kann überhaupt nicht mehr getroffen werden. Somit kann es kaum überraschen, wenn Wissenschaftler davon abraten, die Amplifikation bei PCR-Tests, über eine Anzahl von 24 Zyklen hinaus weiterzuführen (43).

Und nun raten Sie mal, mit wie vielen Zyklen der Drosten-Test fährt, dazu noch einmal ein Zitat von weiter oben:

“Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.” (19iv)

Der Test aus der Charite, kreiert vom kritiklos gefeierten Team um Christian Drosten, definiert zum Nachweis von winzigen Genfragmenten, die man dem Genom des Coronavirus zuordnet, sage und schreibe 45 Zyklen.

Nach oben genanntem Beispiel kämen wir nach 45 Zyklen auf diesen Wert: 35.184.372.088.832. Ein Wert von 35 Billionen, gewonnen aus fast Nichts, ja möglicherweise aus einer oder mehreren Mutationen. Ein Wert der einen Test positiv kennzeichnet, obwohl in der Probe de facto NICHTS enthalten war. Es ist die Krone der Unwissenschaftlichkeit und der endgültige Beweis des vorsätzlichen Missbrauchs des Testes, um “laborbestätigte Fallzahlen” zu generieren.

Es kann für den Autor keine Zweifel geben, dass der Virologe Christian Drosten auch um das Problem einer zu hohen Anzahl gefahrener Zyklen und der Wertlosigkeit von daraus gewonnenen Ergebnissen weiß. Wer sonst sollte es besser wissen? Neben der WHO wissen es die Labore und erst recht weiß es Drosten (44, 45). Und trotzdem berät er die Bundesregierung auf der Basis von Zahlen, die mit einem gröblichst missbrauchten Test ermittelt wurden und zur Bewertung einer epidemiologischen Lage nie und nimmer herangezogen werden dürften. Er tut es wider besseren Wissens. Warum auch immer: Christian Drosten betrügt mit “seinem” Test Politiker, Behörden, Medien und die Bevölkerung. Und die wiederum lassen sich betrügen, weil sie aus diversen Gründen unfähig sind, diesen doch recht simplen Taschenspielertrick zu erkennen und vor allem anzuerkennen.

Wie empfindlich dieser PCR-Test reagiert, ist für den nicht mit der Methode Vertrauten nur schwer vorstellbar. Kary B. Mullis, der Erfinder dieser Methode, sagte dazu bereits im Jahre 1990 – und damit ohne jede politische Intention – das Folgende:

“Ausgehend von einem einzigen Molekül der Erbsubstanz DNA kann man damit an einem Nachmittag 100 Milliarden Kopien des gewünschten Abschnitts erzeugen — und alles ohne großen Aufwand: Man braucht nur ein Reagenzglas, ein paar Zutaten und eine Wärmequelle. Die zu kopierende DNA muß nicht einmal in gereinigter Form vorliegen; ein Quentchen davon in einem hochkomplizierten Gemisch biologischer Substanzen genügt. Sie kann aus der Gewebeprobe eines Kranken stammen, aber auch aus einem einzigen menschlichen Haar, einem eingetrockneten Blutstropfen am Ort einer Gewalttat, einem mumifizierten Gehirn oder einem 40000 Jahre alten Mammut, das im Dauerfrostboden leidlich konserviert worden ist.” (46)

Die manipulative Anwendung des PCR-Tests durch das Fahren übermäßig vieler Zyklen zur Amplifizierung ist der offensichtlichste Betrug in einer ganzen Reihe weiterer. Würden die wohlbekannten Limits zur maximalen Anzahl von Zyklen eingehalten, wäre die angebliche Pandemie von einem Tag auf den anderen beendet. Und das unabhängig des Sachverhalts, dass da nicht einmal ein Virus, sondern nur eine wirklich, winzig, winzig kleine Gensequenz nachgewiesen wird.

“Eine neue Studie der Infectious Diseases Society of America ergab, dass bereits bei 25 Zyklen 70% der “positiven” PCR-Tests gar keine “Fälle” sind, da das Virus nicht kultiviert werden könne. Bei einem CT von 35 ergab sich bei 97% der Testpositiven kein klinisches Bild.” (47, 48)

Auf einen Schlag läge die Anzahl täglicher “laborbestätigter Fälle” in Deutschland nicht mehr bei 10- bis 30.000 sondern zwischen 300 und 900. Entsprechend schrumpfte die Gesamtzahl der in Deutschland “an oder mit Covid-19 Gestorbenen” auf etwa 1.500, was nicht einmal mit einer durchschnittlichen Grippewelle konkurrieren könnte. PCR-Tests die über 35 Zyklen hinaus amplifizieren, liefern schlicht Datenschrott (49) und gleichzeitig Propagandamaterial, um eine Pandemie, die keine ist, weiter zu befeuern.

Obiges ließe dabei immer noch außer acht, dass nur auf Minisequenzen von Genen getestet, Spezifitätstests mangelhaft oder gar nicht durchgeführt werden, die Extraktion der “Isolate” diskussionswürdig ist, verbindliche Standards für den Test nicht existieren, die Probenentnahme keinerlei Ansprüchen auf Repräsentativität und Transparenz genügt, Mehrfachtestungen gang und gäbe sind und diese “laborbestätigten Fälle” eine Untersuchung auf Symptomatiken nicht beinhalten. Allein der Umgang mit der Zyklenzahl zur Amplifizierung der Erbsubstanz weißt uns darauf hin, dass:

diese Pandemie erstunken und erlogen ist!

Wir können davon ausgehen, dass es genug Labore gibt, welche diese ja im “Goldstandard” vorgeschriebenen 45 oder zumindest mit weit über 30 Zyklen fahren (50, 51). Wie die Positivergebnisse auf SARS-CoV-2 zustande kamen, müssen die Labore auch nicht offen kommunizieren (52, 53). Es gibt diesbezüglich keine verbindlichen Standards (a8). Ein höchst erstaunliches Gebaren, wo es doch angeblich um Leben und Tod geht und deshalb Transparenz oberstes Gebot wäre.

Keine Suche nach Viren!

Selbst wenn die seit fast einem Jahr betriebenen Tests in der Lage wären, ein “neuartiges Virus” in seiner Gänze nachzuweisen, so genügten diese trotzdem in keiner Weise, um Infektionen oder gar Krankheiten nachzuweisen. Dieser Sachverhalt gilt unabhängig davon, ob es das SARS-CoV-2 — Virus nun gibt oder nicht. Niemals ersetzen Tests Diagnosen und erst recht stellen Tests keine Krankheiten fest!

Krankheiten äußern sich durch Symptome und die äußern sich zuerst in der subjektiven Befindlichkeit des Patienten. Auf welche Krankheit diese Symptome hinweisen könnten, kann ein Arzt feststellen, der nicht nur den Patienten untersucht, sondern sich auch mit dessen diesbezüglich relevanten Biografie bekannt macht (Anamnese). Diagnosen sind immer individuell und nicht automatisierbar.

Was jedoch immer und immer wieder unter den Tisch gekehrt wird, ist der Fakt, dass die PCR-Methode niemals nach Viren, sondern nach Gensequenzen, nach RNS (RNA) oder DNS (DNA) sucht. Diese Gensequenzen sind dazu noch extrem kurz und sie als solche exklusiv einem Erreger zuzuschreiben, hat mit Wissenschaft überhaupt nichts, mit Ideologie und der Durchsetzung politischer Agenden um so mehr zu tun.

Das ist auch der Grund, warum die Hersteller von PCR-Testkits zwar seit Monaten glänzende Geschäfte machen, sich aber aus der Haftung wohl bedacht herausnehmen. Sie weisen explizit darauf hin, dass der PCR-Test nicht zur Diagnose geeignet ist. So lesen wir zum Beispiel bei Creative Diagnostic:

“Dieses Produkt dient zum Nachweis für das 2019-Novel Coronavirus (2019-nCoV). Der Nachweis auf Basis dieses Produkts dient lediglich als klinische Referenz und sollte nicht als alleiniger Nachweis für die klinische Diagnose und Behandlung verwendet werden.” (54)

Der Pharmariese Merck warnt mehrfach sowohl bei der Nutzung seiner beworbenen Sonden und Primer für SARS-CoV-2 – Gensequenzen, als auch bei der Auswertung der Tests:

“Nur für Forschungszwecke. Nicht zur Verwendung in diagnostischen Verfahren vorgesehen.” (55)

Der US-amerikanische Anbieter BIOMEME erinnert:

“Positive Ergebnisse sind ein Hinweis auf das Vorhandensein von SARS-CoV-2 — RNA. Ein klinischer Abgleich mit Patientenanamnese und anderen diagnostischen Verfahren ist erforderlich, um den Infektionsstatus des Patienten zu bestimmen. Positive Ergebnisse schließen eine bakterielle Infektion oder eine Co-Infektion mit anderen Viren nicht aus. Der nachgewiesene Erreger [nachgewiesen ist die RNA-Sequenz] ist möglicherweise nicht die eindeutige Ursache der Erkrankung” (56)

Auf diese Weise sichern sich alle Hersteller ab, sowohl die von Testkits als auch die von Anlagen zur labortechnischen Auswertung (57, 58).

Das schert weder den RKI-Chef Lothar Wieler noch die Bundes- und Landesbehörden, erst recht nicht die Massenmedien und führende politische Sprachrohre. Es schert auch nicht angebliche Gesundheitsexperten wie den Hysteriker Karl Lauterbach und auch nicht gefeierte Virologen wie Christian Drosten. Der PCR-Test und die Diagnose von Covid-19 ist bei diesen Leuten das Gleiche. Und diese Leute wissen, dass sie lügen.

Daher lässt sich mit Fug und Recht behaupten:

Der PCR-Test kann keine SARS-CoV-2 – Viren identifizieren, sein technologischer Ansatz lässt es nicht zu. Damit kann er auch niemals Aussagen zu Infektionen oder gar Krankheiten treffen, sondern allenfalls Indizien liefern und mehr nicht (59). In Bezug auf das “neuartige Virus” testet er auf extrem kurze, dem Virus zugeschriebene Gensequenzen. Wer von Covid-19 – Fällen in Folge positiv ausgefallener PCR-Tests spricht, verbreitet Unwahrheiten.

Das hat weitere Konsequenzen:

Eine Verbindung von sogenannten laborbestätigten Fällen auf Positivergebnisse von RNA-Sequenzen zum Einen und Krankheiten und Todesfällen zum Anderen herzustellen, ist völlig willkürlich und in keiner Weise kausal.

Außerdem: Der wissenschaftliche Beweis, dass die durch den PCR-Test angezeigten Gensequenzen ursächlich verantwortlich für die Covid-19 zugeschriebenen Krankheitssymptome wären, wurde niemals erbracht!

Daher sind alle Maßnahmen im Rahmen der sogenannten nichtpharmazeutischen Intervention nicht nur unverhältnismäßig und rechtswidrig. Sie sind kriminell. Denn als Basis dient ein Betrugsmodell und dafür missbraucht man bis zum heutigen Tage den PCR-Test. Kriminelles Handeln sollten wir nicht unterstützen, es dafür aber — wo immer es uns möglich ist — aufdecken. Wir sollten uns auch nicht weiter kriminellem Handeln unterwerfen. Die Zeit ist reif.

Bitte bleiben Sie sehr aufmerksam, liebe Leser.


Anmerkungen und Quellen

(Allgemein) Dieser Artikel von Peds Ansichten ist unter einer Creative Commons-Lizenz (Namensnennung – Nicht kommerziell – Keine Bearbeitungen 4.0 International) lizenziert. Unter Einhaltung der Lizenzbedingungen kann er gern weiterverbreitet und vervielfältigt werden. Bei Verlinkungen auf weitere Artikel von Peds Ansichten finden Sie dort auch die externen Quellen, mit denen die Aussagen im aktuellen Text belegt werden. Letzte Bearbeitung: 20. März 2021.

(a1) So es der Autor richtig versteht, haben die Isolate von Patientenproben, welche man kultiviert, um DNS- oder RNS-Sequenzen zu detektieren, mitnichten etwas mit einem (isolierten) Virus zu tun.

(a2) Da wir uns im deutschen Sprachraum bewegen, benutzt der Autor auch die deutschsprachigen Ausdrücke RNS (für Ribonukleinsäure) und DNS (Desoxyribonukleinsäure). In den Medien finden wir in der Mehrzahl die englischsprachigen Pendants RNA (RiboNucleid Acid) und DNA (DeoxyriboNucleid Acid); siehe: Ribonukleinsäure; https://de.wikipedia.org/wiki/Ribonukleins%C3%A4ure; und: Desoxyribonukleinsäure; https://de.wikipedia.org/wiki/Desoxyribonukleins%C3%A4ure; jeweils abgerufen: 22.01.2021

(a2) Übersetzungen aus dem Englischen unter Zuhilfenahme von DeepL.org

(a3) Jeden Hinweis auf eine möglicherweise ja doch existierende wissenschaftlich begründete Dokumentation zum vollständigen Nachweis des “neuartigen Virus” nehme ich gern entgegen und werde diesen gründlich prüfen. Hierzu werde ich den Rat von Medizinern und Mikrobiologen hinzuziehen.

(a4) Die PCR-Methode zielte ursprünglich auf die Kontrolle von Rein- und Reinsträumen zur Herstellung von Mikro-Chips. Sie wurde in den 1980er Jahren im Zuge der AIDS-Forschung für die Medizin entdeckt und sollte — mit sehr, sehr hoher Sensitivität designed — sicher die RNS des HI-Virus nachweisen.

(a5) RT-qPCR steht für Reverse Transcription Quick Time Polymerase Chain Reaction, das kleine ‘q’ (Quick Time) weißt darauf hin, dass der Test in Echtzeit Positivwerte signalisiert.

(a6) Das E-Gen als Ganzes ist 228 Basen lang. Der PCR-Test detektiert nur auf einen Teil dieses Gens, genannt E2, welches 76 Basen lang ist; siehe: 18.03.2020; NCBI, Gendatenbank; Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome; https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3?from=26245&to=26472

(a7) Zum Vergleich vom US-Gesundheitsministerium vorgegebene Primer-Konzentrationen, man betrachte die Werte für das N-Gen: 29.05.2020; Center for Disease Control and Prevention (CDC); 2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel — Primers and Probes; https://www.cdc.gov/coronavirus/2019-ncov/downloads/rt-pcr-panel-primer-probes.pdf; “ZEN™ Internal Quencher positioned between the ninth (9th) and tenth (10th) nucleotide base in the oligonucleotide sequence and Iowa Black® FQ (3IABkFQ) located at the 3’-end (Integrated DNA Technologies, Coralville, IA).”

(a8) Über vertrauenswürdige Quellen erfuhr ich, dass in Deutschland zwar auch Labore gibt, welche Tests mit vernünftigen Ct-Werten fahren, aber insgesamt mit den Empfehlungen des Drosten’schen “Goldstandard” hantiert wird, Zitat aus Quelle des Autor: “Auf telefonische Nachfrage hin erklärte man kürzlich, mehr als 30 Zyklen würde konkret 45 Zyklen heißen. Von anderen Laboren weiß ich, daß die Zyklenzahl auf 27 begrenzt wird.”

(1) 29.01.2020; The Lancet; Roujian Lu, Xiang Zhao, Juan Li und weitere; Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding; Lancet 2020; 395: 565–74; Published Online January 29, 2020; https://doi.org/10.1016/S0140-6736(20)30251-8; https://www.thelancet.com/pdfs/journals/lancet/PIIS0140-6736(20)30251-8.pdf

(2) 16.01.2020; Charité; Erster Test für das neuartige Coronavirus in China entwickelt; https://www.charite.de/service/pressemitteilung/artikel/detail/erster_test_fuer_das_neuartige_coronavirus_in_china_entwickelt/

(3 bis 3ii) 20.02.2020; Na Zhu, Ph.D., Dingyu Zhang, M.D., Wenling Wang, und weitere; A Novel Coronavirus from Patients with Pneumonia in China, 2019; Kap. Isolation of Virus;  https://www.nejm.org/doi/full/10.1056/nejmoa2001017

(4) 09.04.2013; Simply Science; Was ist DNA?; https://www.simplyscience.ch/teens-liesnach-archiv/articles/was-ist-dna.html

(5) 2020; Bayerisches Landesamt für Umwelt (LFU Bayern); DNA-Amplifikation (PCR); https://www.lfu.bayern.de/analytik_stoffe/biol_analytik_dna_untersuchungen/dna_amplifikation/index.htm

(6) 04.09.2018; DocCheck Flexikon; Patrick Messner, Frank Antwerpes, Norbert Ostendorf; Sanger-Sequenzierung; https://flexikon.doccheck.com/de/Sanger-Sequenzierung

(7) Oktober 2020; Corona Fakten; Samuel Eckert; Die Irrtümer der Virologen und die Binder-Labs; https://samueleckert.net/die-irrtuemer-der-virologen-und-die-binder-labs/

(8) 18.12.2018; BMC Informatics; Joshua B. Singer, Emma C. Thomson, John McLauchlan und weitere; GLUE: a flexible software system for virus sequence data; https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2459-9

(9) https://en.wikipedia.org/wiki/List_of_sequence_alignment_software; abgerufen: 15.12.2020

(10) Nakamura T, Yamada KD, Tomii K, Katoh K. Parallelization of MAFFT for large-scale multiple sequence alignments. Bioinformatics 2018; 34: 2490–92.; verlinkt bei (1), S. 568

(11) Study Help; DNA / DNS Grundlagen; https://www.studyhelp.de/online-lernen/biologie/dna/; abgerufen: 13.12.2020

(12) 15.05.2003; nature; Koch’s postulates fulfilled for SARS virus; https://www.nature.com/articles/423240a; Fouchier, R., Kuiken, T., Schutten, M. et al. Koch’s postulates fulfilled for SARS virus. Nature 423, 240 (2003). https://doi.org/10.1038/423240a

(13) 03.07.2020; Corona-Fakten; Führende Corona Forscher geben zu, dass sie keinen wissenschaftlichen Beweis für die Existenz eines Virus haben; https://telegra.ph/Alle-f%C3%BChrenden-Wissenschaftler-best%C3%A4tigen-COVID-19-existiert-nicht-07-03

(14) 24.01.2020; The Lancet; Chaolin Huang, Yeming Wang, Xingwang Li und weitere; Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China; https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30183-5/fulltext

(15, 15i) Prinzip der Polymerase-Kettenreaktion (PCR); https://de.wikipedia.org/wiki/Reverse-Transkriptase-Polymerase-Kettenreaktion#Prinzip; abgerufen: 14.01.2021

(16) 2013; Kai Ilmo Ehnts; Entwicklung von Rekombinase-Polymerase-Amplifikations-Nachweisverfahren für virale Erreger von Atemwegsinfektionen; https://ediss.uni-goettingen.de/bitstream/handle/11858/00-1735-0000-0001-BAD4-F/Dissertation%20Ehnts.pdf?sequence=1; S. 27, Kap. Methoden; Anmerkung des Autors: Eine gut verständliche, straff geführte Abhandlung zum Nachweis von Influenza-Viren zugeschriebenen Gensequenzen

(17) Wissenschaft Plus; Stefan Lanka; Virologen die krankmachende Viren behaupten sind Wissenschaftsbetrüger und strafrechtlich zu verfolgen; http://wissenschafftplus.de/uploads/article/wissenschafftplus-virologen.pdf; S. 6

(18) 16.06.2020; EMM; Myungsun Park, Joungha Won, Byung Yoon Choi & C. Justin Lee; Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR; Kap. RNA extraction; Kap. Materials and methods; https://www.nature.com/articles/s12276-020-0452-7

(19 bis 19iv) 23.01.2020; Eurosurveillance;  Victor M. Corman, Olfert Landt, Marco Kaiser, Christian Drosten und weitere; Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR; Kap. Real-time reverse-transcription PCR; https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/

(20) 20.02.2020; NEJM; Na Zhu, Dingyu Zhang, Wenling Wang und weitere; A Novel Coronavirus from Patients with Pneumonia in China, 2019; https://www.nejm.org/doi/full/10.1056/nejmoa2001017

(21) Sanger-Sequenzierung innerhalb der PCR; https://de.wikipedia.org/wiki/Frederick_Sanger#Methode_zur_Sequenzierung_von_Nukleins%C3%A4uren; abgerufen: 22.01.2021

(22) 14.01.2020; NCBI; GenBank: MN908947.2; Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome; https://www.ncbi.nlm.nih.gov/nuccore/MN908947.2

(23) 18.03.2020; NCBI; Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome; https://www.ncbi.nlm.nih.gov/nuccore/MN908947

(24) Eurofins Genomics; rRT-PCR Primers & Probes for nCoV Coronavirus, Primers and probes recommended by the CDC & WHO; https://eurofinsgenomics.eu/en/dna-rna-oligonucleotides/optimised-application-oligos/ncov-qpcr-assays/; abgerufen: 17.12.2020 

(25) 20.03.2020; AGES — Wissen aktuell; Vergleich unterschiedlicher Nukleinsäure-Amplifikationssysteme für SARS-CoV-2; https://www.ages.at/wissen-aktuell/publikationen/vergleich-unterschiedlicher-nukleinsaeure-amplifikationssysteme-fuer-sars-cov-2/

(26) WHO; Diagnostic detection of Wuhan coronavirus 2019 by real-time RT-PCR-Protocol and preliminary evaluationas of Jan 13, 2020; Victor Corman, Tobias Bleicker, Sebastian Brünink, Christian Drosten — Charité Virology, Berlin, Germany; Olfert Landt, Tib-Molbiol, Berlin, Germany; https://www.who.int/docs/default-source/coronaviruse/wuhan-virus-assay-v1991527e5122341d99287a1b17c111902.pdf

(27) cDNA oder komplementäre DNS; https://de.wikipedia.org/wiki/CDNA; abgerufen: 23.01.2021

(28) Biologie-Seite; Ribonuklease; https://www.biologie-seite.de/Biologie/Ribonuklease; und: Ribonukleasen; https://de.wikipedia.org/wiki/Ribonukleasen; jeweils abgerufen: 24.01.2021

(29) 16.01.2020; DZIF; Erster Test für das neuartige Coronavirus in China ist entwickelt; https://www.dzif.de/de/erster-test-fuer-das-neuartige-coronavirus-china-ist-entwickelt

(30, 30i) PCR-Optimierung, Degenerierte Primer, Forward und Reverse Primer-Design; https://de.wikipedia.org/wiki/Primerdesign#Degenerierte_Primer; abgerufen: 24.01.2021

(31) Molbiol; Designer für PCR-Primer; https://molbiol-tools.ca/PCR.htm; abgerufen 10.12.2020

(32) 25.06.2015; Universität Bielefeld; C. Schleiermacher, D. Hagemeier, T. Gatter; genefisher2; Beispiel für ein webbasiertes Programm zum Design degenerierter Primer; https://bibiserv.cebitec.uni-bielefeld.de/genefisher2/

(33) 27.11.2020; Pieter Borger, Bobby Rajesh Malhotra, Michael Yeadon; External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results.; B) Methods And Results, 1. Primer & Probe Design; 1a) Erroneous primer concentrations; https://cormandrostenreview.com/report/

(34) 30.11.2020; Antrag zur Zurückziehung wegen Mängeln; https://2020news.de/drosten-pcr-test-studie-rueckzugsantrag-gestellt-wegen-wissenschaftliche-fehler-und-massiver-interessenkonflikte/; siehe auch: 28.11.2020; https://cormandrostenreview.com/retraction-request-letter-to-eurosurveillance-editorial-board/

(35) 11.01.2021; Addendum zum Rückzugsantrag; https://2020news.de/20-gegen-drosten-neues-kapitel-im-retraction-prozess/; siehe auch: https://cormandrostenreview.com/addendum/

(36) 06.12.2020; Fassadenkratzer; Internationale Experten: Drosten-PCR-Test wegen schwerwiegender Mängel völlig untauglich für Infektions-Nachweis; https://fassadenkratzer.wordpress.com/2020/12/06/internationale-experten-drosten-pcr-test-wegen-schwerwiegender-mangel-vollig-untauglich-fur-infektions-nachweis/

(37) 01.06.2020; Theranostics; Dandan Li, Jiawei Zhang, Jinming Li; Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2; Table 2; https://www.thno.org/v10p7150.htm

(38) Ablauf der Polymerase-Kettenreaktion; https://de.wikipedia.org/wiki/Polymerase-Kettenreaktion#Ablauf; abgerufen: 23.01.2020

(39) Synthese von cDNA; https://de.wikipedia.org/wiki/CDNA#Synthese; abgerufen: 23.01.2021

(40) Bayerisches Landesamt für Umwelt; DNA-Amplifikation (PCR); https://www.lfu.bayern.de/analytik_stoffe/biol_analytik_dna_untersuchungen/dna_amplifikation/index.htm; abgerufen: 23.01.2021

(41) 15.07.2020; Bioscientia; Was bedeuten die Begriffe Dual-Target-PCR und Ct-Wert?; https://www.bioscientia.de/de/home/aktuelles/2020/07/was-bedeuten-die-begriffe-dual-target-pcr-und-ct-wert

(42) 02.06.2020; Medica Magazin, Universität Konstanz; Covid-19-Schnelltestverfahren auf Basis von DNA-Polymerasen; https://www.medica.de/de/News/Archiv/Covid-19-Schnelltestverfahren_auf_Basis_von_DNA-Polymerasen

(43) 10.06.2020; DGN; Jared Bullard, Kerry Dust, Duane Funk und weitere; Vorhersage der Infektiosität von SARS-CoV-2 bei positiver PCR; https://dgn.org/neuronews/journal_club/vorhersage-der-infektiositaet-von-sars-cov-2-bei-positiver-pcr/; übersetzt aus: 22.05.2020; Oxford Academic; Predicting Infectious Severe Acute Respiratory Syndrome Coronavirus 2 From Diagnostic Samples; https://academic.oup.com/cid/article/71/10/2663/5842165; auch bei PubMed; Predicting infectious SARS-CoV-2 from diagnostic samples; https://pubmed.ncbi.nlm.nih.gov/32442256/

(44) 05.08.2020; MVZ Labor Ravensburg; Was bedeutet der Ct-Wert?; https://www.labor-gaertner.de/fileadmin/user_upload/Dokumente/pdf/Aktuelles/LaborwissenKonrekt_SARS-CoV-2_Ct-Wert.pdf

(45) 2014; Wirtschaftswoche; Christian Drosten im Gespräch; “Der Körper wird ständig von Viren angegriffen”; https://www.wiwo.de/technologie/forschung/virologe-drosten-im-gespraech-2014-die-who-kann-nur-empfehlungen-aussprechen/9903228-2.html

(46) 01.06.1990; Spektrum; Kary B. Mullis; Eine Nachtfahrt und die Polymerase-Kettenreaktion; https://www.spektrum.de/magazin/eine-nachtfahrt-und-die-polymerase-kettenreaktion/944869

(47) 28.09.2020; Oxford Academic; Rita Jaafar, Sarah Aherfi, Nathalie Wurtz und weitere; Correlation Between 3790 Quantitative Polymerase Chain Reaction–Positives Samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates; https://academic.oup.com/cid/advance-article/doi/10.1093/cid/ciaa1491/5912603

(48) 08.12.2020; Zeitpunkt; Erstmals verlangt eine Behörde die Offenlegung der Anzahl Zyklen beim PCR-Test; https://www.zeitpunkt.ch/erstmals-verlangt-eine-behoerde-die-offenlegung-der-anzahl-zyklen-beim-pcr-test

(49) 24.11.2020; Prof. Harald Wallach; Masken, Intensivbetten, PCR-Tests, Impfungen – Die apokalyptischen Reiter der Coronakrise stolpern durch den Wald der Fakten; Kapitel: Der PCR-Test und seine Aussagekraft; https://harald-walach.de/2020/11/24/masken-intensivbetten-pcr-tests-impfungen-die-apokalyptischen-reiter-der-coronakrise-stolpern-durch-den-wald-der-fakten/#more-2894

(50) 18.03.2020; AGES, Ingenetix; Vergleich unterschiedlicher Nukleinsäure-Amplifikationssysteme für SARS-CoV-2; Florian Gruber, Peter Hufnagel; https://www.ingenetix.com/wp-content/uploads/2020/03/Vergleichsstudie_SARS-CoV-2.pdf; S. 1

(51) 07.12.2020; Science Files; PCR-Tests: Viel (?) zu hohe Fallzahlen; https://sciencefiles.org/2020/12/07/pcr-tests-viel-zu-hohe-fallzahlen/; siehe auch Grafik im Text

(52) 07.10.2020; ARD-Tagesschau; Markus Grill, Mara Leurs; Gesundheitsämter bekommen keine Laborwerte; https://www.tagesschau.de/investigativ/ndr-wdr/gesundheitsaemter-corona-tests-103.html

(53) 10.10.2020; Bayerische Landesärztekammer; Pressemeldung: Aussagekraft von PCR-Tests auf SARS-CoV-2 erhöhen; https://www.blaek.de/meta/presse/presseinformationen/presseinformationen-2020/aussagekraft-von-pcr-tests-auf-sars-cov-2-erhoehen

(54) 21.03.2020; Creative Diagnostics; SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit; http://web.archive.org/web/20200321205248/https://www.creative-diagnostics.com/sars-cov-2-coronavirus-multiplex-rt-qpcr-kit-277854-457.htm

(55) Merck; Fallstudie zum Coronavirus-qPCR-Design & Produkte für die SARS-CoV-2-Forschung; https://www.sigmaaldrich.com/germany/ncov-coronavirus.html; abgerufen: 17.12.2020

(56) 20.08.2020; Food and Drug Administration USA (FDA); Biomeme; Biomeme SARS-CoV-2 Real-Time RT-PCR Test; https://www.fda.gov/media/141052/download; S.4/5

(57) Food and Drug Administration USA (FDA); Kogene Biotech; https://www.fda.gov/media/140069/download; S. 2; abgerufen: 17.12.2020

(58) 17.12.2020; Roche; Allgemeine Informationen zu SARS-CoV-2; https://www.roche.de/diagnostik-produkte/produktkatalog/tests-parameter/sars-cov-2-cobas-6800-8800/

(59) 10.06.2020; Deutsche Gesellschaft für Neurologie; Vorhersage der Infektiosität von SARS-CoV-2 bei positiver PCR; https://dgn.org/neuronews/journal_club/vorhersage-der-infektiositaet-von-sars-cov-2-bei-positiver-pcr/; Zitat aus kanadischer Studie: “Die RT-PCR weist RNA nach, aber nicht die Infektiosität eines Virus, sodass das Ansteckungsrisiko, das beispielsweise von einem Patienten mit persistierend positiver PCR ausgeht, unbekannt ist. Für die durch das öffentliche Gesundheitswesen zu ergreifenden Maßnahmen ist jedoch entscheidend, ob ein Patient infektiös ist.”

(b1, b1i, b1ii) EMM; PCR primer design and optimization guidelines, SARS-CoV-2 genome map, and targets of primer sets; https://www.nature.com/articles/s12276-020-0452-7/figures/1; entnommen: 12.12.2020

(b2) Die Doppelhelix wird durch die Helikase und die Topoisomerase geöffnet. Danach setzt die Primase einen Primer und die DNA-Polymerase beginnt, den leading strand zu kopieren. Eine zweite DNA-Polymerase bindet den lagging strand, kann aber nicht kontinuierlich synthetisieren, sondern produziert einzelne Okazaki-Fragmente, welche von der DNA-Ligase zusammengefügt werden.; Autor: Madprime; September 2010; Quelle: Wikimedia; https://upload.wikimedia.org/wikipedia/commons/3/33/DNA_replication_split_horizontal.svg; Lizenz: GNU Free Documentation License

(b3) siehe (19)

(Titelbild) Mikroskop, Analyse, Labor; Autor: Chokniti Khongchum (Pixabay); 13.04.2019; https://pixabay.com/de/photos/analyse-becher-biochemie-biologie-4402809/; Lizenz: Pixabay License

Aufrufe: 4

Von Ped

95 Gedanken zu „Der Betrug mit dem PCR-Test“
  1. Der Betrug funktioniert nur so lange, wie die Menschen betrogen werden wollen. Viele wollen noch nicht glauben, dass ihr demokratisches, rechtsstaatliches Superland mittlerweile totalitär, willkürlich und kriminell regiert wird.
    Zu den Todeszahlen: Das CDC musste zugeben, dass nur ca. 6% aller Todesfälle an “COVID-Lungenentzündung” gestorben sei, wobei selbst auch dabei noch Fragezeichen zu setzen sind, wie im Text so gut beschrieben. Das wären, da in D ja ähnlich an und mit vermengelt wurde, die ca. 1500 “echten” Todesfälle. Also ca. 0,15 % aller Toten, eine sehr seltene Todesart.

    1. “Fragezeichen”, @Anette, ist gut!!!!

      “Lungenentzündung”…. kann eine Lungenembolie sein. Mögliche Ursachen: Eine Thrombose, eine Ankündigung auf ein Karzinom (Krebs). Erfordert Abklärung. Zu “Thrombose”… “DNA”. z.B.
      Zu “Karzinom”… Magenspiegelung, Darmspiegelung, CT, Blutbild, zielgerichtet. u.e.a.
      Viel öfter habe ich “Krankenhauskeime” erlebt (einfach ausgedrückt). Wie ältere Menschen (auch junge), sobald sie bettlägrig wurden, in dem geschlossenen Umfeld des Krankenzimmers an einer “Lungenentzündung” litten, diese nicht oder nur unter großem Aufwand durch das Fachpersonal therapiert werden konnten, weiß’ ich nur zu gut.

      Ausgehend davon, das ich kürzlich in einem “Oberlausitzer Kurier” eine “Danksagung” für einen mit 80 Jahren verstorbenen Vereinsleiter gelesen habe, wo die “dankbaren Kegler” in einem Feld “Corona- Opfer” einsetzen ließen- darf über die Pietätlosigkeit des Anzeigenstellers nachgedacht werden…
      Herausgekommen ist, das der arme Mann als Witwer bereits seit Jahren an fortschreitender Demenz und körperlichem/ geistigen Verfall gelitten hat.
      Nun könnte man noch die Anekdote des 40- Jährigen Verkehrsunfall- Opfers beibringen, welches mit in die “Covid- Toten”- Statistik eingereiht wurde. Zum Beispiel …

      Was sagt uns das?
      Der Verarsche ist noch nicht Genüge getan. Es muss noch schlimmer kommen!
      Dem Lauf des Lebens und des Sterbens wird eine neue Dimension zugeordnet:

      <“Wenn das Geld knapp wird, die Wirtschaft am Boden liegt, ohnehin “Reiche” immer reicher werden und es nur noch China- Fressen aus dem Supermarket gibt- dann ist es Zeit, lebensmüde zu werden und sich von Familie, Freunden, Kindern und Enkeln , soweit überhaupt noch vorhanden, zu verabschieden! In Einsamkeit, von verkleideten weißen Personen ins Jenseits ‘gespritzt'”>

      Tolle Aussichten, was?
      Habe aber noch keine Lust und will bei vollem Verstand so alt werden wie mein Opa: 98!!!!
      Und der war glücklich, weil aktiv und bodenständig (war) und zwei Weltkriege als Soldat überlebt (hat)…

      So soll’s werden! (NICHT als “Soldat”! Bin Pazifist, nach Dienstzeit, und bleibe es auch!!!!!)

      G. Käntzler

  2. Danke für diese gründliche Recherche auf Basis von vielen weltweiten seriösen Publikationen der Wissenschaft.
    Bitte an alle Leser als Multiplikatoren, diese Informationen zu vervielfältigen.

  3. Lieber Ped,
    danke für den Artikel, mit dem Sie sich wieder einmal selbst übertroffen haben – das ist Wissenschaftsjournalismus im besten Sinne, etwas, wozu der Mainstream nicht mehr willens und in der Lage ist!

    Nach meinen entsprechenden Recherchen ist der virologische Goldstandard zum Nachweis einer Infektion (1. Kochsches Postulat), die Virusanzüchtung in einer lebenden Zellkultur, bisher mit zwei Zellinien erfolgreich gewesen, mit Vero E6 – das sind Nierenzellen von Grünen Meerkatzen und mit Caco – 2, unsterblichen Zellen aus einem Colonadenokarzinom.
    Die Proben wurden in beiden Fällen von Abstrichen aus dem oberen Respirationstrakt von Menschen entnommen.

    https://www.nature.com/articles/s41586-020-2332-7

    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7427302/

    Inwiefern diese Nachweise als Infektion des Menschen einzustufen sind, bedarf u. a. einer juristischen Klärung.
    Es könnte immerhin sein, daß die Vermehrung in diesen Zellkulturen nicht als Infektion im juristischen Sinne anzusehen ist, da es sich nicht um Zellkulturen jener Zellen des oberen Respirationstraktes handelt, welche bei einer Erkrankung von Menschen sehr wahrscheinlich befallen sind.
    Ich möchte alle Leser auffordern, diese Aussagen zu falsifizieren!
    Herzlichen Grüße, Steffen Duck

    1. Ich halte die Prüfung der Kochschen Postulate für Viren undurchführbar. Ein Isolat von Viren dürfte nur die Viren und dann nur noch davon klar unterscheidbare andere Bestandteile enthalten. Solchen anderen klar unterscheidbaren Bestandteile wären anorganisches Material oder organisches Material mit deutlich kleineren Molekülgrößen (Beispiel: kleiner 1.000 Dalton) – oder anders physikalisch unterscheidbar.

      MW kann solch ein Isolat nicht hergestellt werden, denn da Viren nur auf Zellkulturen vermehrt werden können, und da Viren nicht rein daraus isoliert werden können, ist damit die Grundbedingung nicht erfüllt.

      “Inzwischen ist bekannt, dass es auch Erreger von Infektionskrankheiten gibt, mit denen sich nicht alle Koch’schen Postulate erfüllen lassen. Viren beispielsweise lassen sich auf einfachen Nährmedien nicht kultivieren,”

      https://de.wikipedia.org/wiki/Henle-Koch-Postulate

      Interessant übrigens, wie gerade an Wikipedia-Artikeln, die Viren, Infektion, etc betreffen herumgeschraubt wird. Es sieht nach einer großangelegten Säuberungswelle aus.

  4. Lieber Ped,

    ein klasse Artikel !

    Wenn es erlaubt ist, darf ich noch zwei kleine Themen zur Klärung erbitten:

    Bezüglich der 76 Basen langen E2-Gensequenz, die bei den meisten Tests zur “Identifikation” des Virus ausreicht habe ich die Frage, wie spezifisch diese Sequenz für das angenommene Sars-cov-2 Virus ist, oder andersherum gefragt, kommt diese Sequenz sonst noch wo vor und ggf. wo (auf Papayas ?)
    Wie erklärt sich die eigentlich geringe Positiven-Rate von zur Zeit 11%, wenn die Tests derartig viel fündig werden. M.E. müssten wir erheblich höhere Positivenraten haben.


    Wie spezifisch das E2-Gen ist? Tja, spezifisch auf was? Und das bei dieser minimalen Länge? Wir wissen es nicht. Vielleicht bildet sie sich gar erst durch Mutationen? Die Sequenz ist einfach zu klein und das Virus, dem man diese zuschreibt, ist bisher – zumindest mir – ja nur als Modell, als Konstrukt bekannt.
    Herzlich, Ped

    1. Hallo Strukturdenker,

      aus meiner Sicht ist die NUR E2 Gen Sequenzierung genau der springende Punkt. Diese Sequenz weisen so ziemlich ALLE Corona Viren auf- vielleicht sogar andere Viren verantwortlich für Atemwegesinfektionen und grippale Infekte.
      Und da nur auf diesem mit dem Drosten Test detektiert wird, untermalt es meiner Meinung nach noch mehr die Betrugsabsicht. Mehr als weltweit 150 bekannte Corona Viren Typen ( krankmachende und auch nicht krank machende), hinzugerechnet dann die davon schnell folgenden und bekannten Mutation, die ganz natürlich sind, wird die Zahl 150 exorbitant noch steigern.
      Es wird ja schon seit langem immerwieder darauf hingewiesen, doch lieber auf das N Gen zu detektieren. Das wird aber nicht gemacht, wie auch nicht auf generell- so aber vorgesehen- einen zweiten bzw dritten Gen Abschnitt zu detektieren.

      Gute Woche allen, Tommi


      Danke, Tommi.
      Was die Auswahl des zu testenden Genes anbetrifft, kommt ein anderes Protein für mich viel mehr in Frage. Und es liegt auf der Hand. Aber ich möchte die Leserschaft noch ein wenig auf die Folter spannen, denn dazu gibt es in der nächsten Woche (so mein Plan) einen gesonderten Artikel.
      Herzlich, Ped

      1. Lieber Ped!
        Haben Sie sich nun entschlossen, “die Folter zu beenden”? Ist der “gesonderte Artikel” noch in Arbeit… oder dürfen wir uns freuen, über neuen Lesestoff und etwas Gehirnjogging?
        Herzlichst
        G. Käntzler


        Geduld, ich habe es im vergangenen Jahr übertrieben mit dem Schreiben und fühle mich angehalten etwas kürzer zu treten.
        Aber der Artikel zum Widerspruch zwischen Testen und Impfen ist in Arbeit.
        Herzlich, Ped

    2. Ach so, wegen der Papaya- Coca Cola Motoröl usw. Test Positiv Ergebnisse.
      Ja, das Funktioniert, aber da wurden die Proben nie aufgearbeitet und vorbereitet für den Test.
      Da wurde die pure Testsubstanz unmittelbar auf den Test aufgetragen.
      Ich wette, das zerstört jeden Test, schon alleine wegen hohem Säureanteil ( Fruchtsäure = Papaya, Phosphorsäure = Coca Cola)
      Ich behaupte, das hält selbst der beste Test nicht aus. 🙂
      Aber einen schönen Effekt hat es und zeigt, wie schnell so ein Test zu manipulieren ist.

    3. Dazu bitte auch meinen Hinweis beachten: nicht das Amplikon (der Bereich zwischen den Primern) wird nachgewiesen, sondern nur der Bereich der Primer selbst. Hat man zB zwei jeweils 20 Basenpaare lange Primer, so wird einzig und nur auf diese 40 Basenpaare getestet – da können dazwischen 10, hundert, oder tausend Amplikon-Basenpaare liegen: die werden alle nicht getestet.

      Einzig eine Untersuchung des angereicherten Materials auf die Moleküllängen zB mittels Elektrophorese, kann eine Hinweis darauf liefern, ob das RICHTIGE Amplikon vervielfacht wurde. Und ob nicht viele verschiedene Amplikons (wenn die Primer auf verschiedenen RNA andocken) vervielfältig wurden.

      http://wikihausen.de/2021/01/06/corona-pcr-test-absichtlich-fehlerhaft-gestaltet-von-drosten-et-al-wikihausen-im-interview/

      Und der Hinweis auf

      https://cormandrostenreview.com

      sollte hier natürlich nicht fehlen (falls nicht schon gegeben)


      Dass auf die Gensequenz selbst, sondern nur auf die Primer getestet wird: Haben Sie dafür belastbare Quellen (nicht aus Videos)?
      Herzlich, Ped

      1. Ped, hast du je die Klageschifft Wodarg gegen Volksverpetzer gelesen?
        Sehr interessant, weil darin exakt und mit Nachweisen gefüllt, der PCR Test und dessen Nichtfunktionieren beschrieben wird. Das ist der Kern der Klageschrift und ein juristischer Trick, sollten sich Gerichte mit der Klage tiefer beschäftigen.
        Grundlage sind die Erkenntnisse von Professor* in Michael Yaedon, Ulrike Kämmerer.

        Habe ich leider nur als PDF Datei. Bei Interesse kann ich zukommen lassen.


        “Ped, hast du je die Klageschrift Wodarg gegen Volksverpetzer gelesen?”

        Ja.
        VG, Ped

      2. Hallo Ped, die belastbare Quelle ist in diesem Fall die Logik (was Sie gegen die Information aus dem Video von Herr Fiedler haben, versteh ich nicht):

        Stellen Sie sich vor, sie suchen einen Text im Internet. Sie haben dazu zwei Wörter zu Verfügung: ein Startwort und ein Endwort. Wenn Sie nun nach dem Text im Internet suchen, kann dieser Text eben nur mit diesen zwei Worten identifiziert werden. Sie haben ja nicht mehr. Was zwischen diesen beiden Worten steht, ist nur genau für den Zieltext definiert. Aber wenn Sie nun auf einen Text stoßen, der AUCH die beiden Suchworte enthält, aber nicht der Zieltext ist, dann steht eben zwischen den beiden Suchworten etwas anderes.

        Wie könnte nun trotzdem so halbwegs sichergestellt werden, ob der Zieltext oder ein anderer Text gefunden wurde? Das könnte man damit machen, dass man die Anzahl der Wörter zwischen Startwort und Endwort zählt, denn diese Anzahl kennt man ja für den Zieltext.

        In der PCR-Analytik macht man das mit der Elektrophorese (“auf Platte gießen”). Dabei werden die Moleküle durch eine elektrische Spannung gezwungen, durch ein Gel zu wandern. Kleine Moleküle wandern schneller als große und sind daher nach einer gewissen Zeit weiter vom gemeinsamen Startpunkt entfernt. Das Gemisch trennt sich auf. Dann werden die Bereiche sichtbar gemacht, in denen die Moleküle sitzen. Man sieht “Bande”. Wenn man eine einzige Bande sieht, hat man alles richtig gemacht: es wurde genau ein Amplikon einer Sequenzlänge vervielfältigt. Wenn man viele Bande hat, ist was faul: es wurden viele verschiedene Amplikons vervielfältigt.

        Ich hoffe, ich konnte damit helfen.

  5. Wow, ich bin nicht mehr in der Lage, diesen fachwissenschaftlichen Erklärungen mit vollem Verständnis zu folgen, und finde trotzdem, dass es für die schwierige Materie bestens aufbereitet und dargestellt ist. Ich danke sehr dafür, weil ich diese – durch und durch – sachliche Kritik für außerordentlich wichtig halte.
    Mein mangelndes Verständnis ist hauptsächlich in sehr detaillierten Bereichen gegeben, allerdings wäre ein Fehler dort mutmaßlich fortführend und also die Gesamtdarstellung trübend.
    Einzig aus diesem Grund, nachträglich zu redigieren, werde ich Bekannte, vor allem Schulfreunde mit speziell fachwissenschaftlicher Bildung darum bitten, zu “scannen”. Auch wenn ich hoffe, dass einfach nichts zu finden wäre, so will ich andererseits hoffen, dass zumindest zu “verniedlichende Ungenauigkeiten”, aber eben doch kleinere Fehler gefunden werden, damit umgekehrt das Ganze damit als bestätigt betrachtet werden kann. Zu sehr habe ich die Befürchtung, dass diese (von mir gewünschte) “Beckmesserei”, die – wissenschaftliche Kritik – allein aus politischen Gründen von dem einen oder anderen unterbliebe.
    Ganz in diesem Sinne wünsche ich Dir, Ped, fundierte Kritik, die ich Dir übermitteln werde, sofern sie mir statt Deiner anvertraut würde.


    Ja, sehr gern. Mir bricht kein Stein aus der Krone, wenn sachlich und fair eine Falsifikation dieser Arbeit vorgenommen wird. Es kann dieser und meinem Verständnis zur Sache nur gut tun.
    Herzlich, Ped

  6. Lieber Ped,

    auch von mir einen herzlichen Dank für diesen umfangreichen Artikel zum PCR Test und dem allgemein sehr schwierigen Thema, dass aufzuarbeiten. Ein Artikel zum absolut weiterreichen, auch wenn es für den Leser wegen der vielen wissenschaftlichen Begriff und Beschreibungen dessen, was da eigentlich im Test passiert, was er ist und was er eben NICHT ist.

    Die Einführung fand ich besonders gut.
    Es ist wichtig zu verstehen, wo und durch was es begann (China) und welche Fragwürdigkeiten sich im Kontext dazu schon ergeben.

    Einen Sachverhalt habe ich ein wenig vermisst, auch wenn das zum Artikel eher Zweitrangig ist:

    Der Sachverhalt, das sich bei einer Probenentnahme, z.B. Mund- Nasen- Rachenraum, sich in dieser auch schon Fragmente (und nur noch) eines Erreger befinden können, weil unser Immunsystem schon längst einen Virusbefall bekämpft hatte, die Trümmer der beginnenden Abwehrschlacht auf den Schleimhäuten und der Sieg des Körpers gegen ein Virus schon dort gewonnen wurde, ohne jemals zu erkranken. Auch eine echte durchgemachte und überbestandene Infektionen wird vermutlich Trümmer auf der Schleimhaut nachweisen lassen.

    Die Quellenangabe wie immer, traumhaft, werden vermutlich selten nachvollzogen durch Rezipienten.
    Vielleicht ist es für Dich möglich, die Fußnote zur jeweiligen Quelle im Text direkt zu verlinken, klickt man darauf. Weiß nicht ob die Board Technik das hergibt. So aber würde man sicher öfter zur Quelle linken. Bei umfangreichen Texten im Nachgang nochmal nach oben zum Text scrollen, um nochmal die Zahl der Fußnote zu sehen, dann wieder runter scrollen zu den sehr umfangreiche Quellenangaben, da scheut man schnell. 😉

    Freue mich auf deinen genannten weiterführenden Artikel zum Thema,

    lieben Gruß, Tommi.

  7. In kurz:

    die Rede von den angeblich Covid-Infizierten, die mit dem PCR-Test ermittelt worden wären, stimmt mehr als dreimal nicht:
    _ weder ist ein Virus nachgewiesen (sondern nur Bruchstücke)
    _ weder ist ein Eindringen nachgewiesen (sondern nur Anhaftungen auf Oberflächen, Schleimhäuten, Grenzflächen, also außerhalb der Körperbarrieren)
    _ noch und schon gar nicht ist eine Ansiedelung nachgewiesen
    _ erst recht nicht ist eine Vermehrung nachgewiesen

    wir werden nur noch verarscht. Der Pharma-Komplex ist die größte Verbrecherbande aller Zeiten, tausendmal schlimmer als die Mafia Al Capones.

    1. und in Ergänzung zu den hier dargestellten Informationen: nicht einmal auf ein bestimmte, einzigartige Gensequenz wird zuverlässig nachgewiesen.

      Damit haben wir dann schon 5 Punkte, die die Lüge über die angeblichen Infizierten-Zahlen wirklich unglaublich riesig machen.

      In einer Nussschale die Wahrheit: ein positiver PCR-Test liefert nichts weiter als einen SCHWACHEN Hinweis und nur bei einem tatsächlich und nach persönlicher Wahrnehmung Atemwegs-KRANKEN auf EINE mögliche Ursache der Erkrankung (im Zusammenhang einer Differentialdiagnose).


      Wie gesagt, dass keine Detektion auf die Gensequenz selbst (z.B E2 oder RdRP2) erfolgt, bedarf belastbarer Belege.
      Grüße, Ped

      1. Hallo Ped, die belastbaren Belege sind die Fakten. Nur müssen die eben noch durchdringen. Es ergibt sich schlicht aus der Sache und der Logik: Nur die Primer sind definiert. Nur die Primer docken sich bei korrekter Arbeitsweise an eine quasi spielgelbildlichen Bereich des Basenstranges an. Was zwischen den Primern liegt ist dabei völlig egal. Und wenn Du mir nicht glaubst, glaube es dem Biologen Markus Fiedler und seinem Kollegen aus dem Labor. Ich habe den Link auf die aufschlussreiche Wikihausen-Sendung gesetzt.
        Problematisch ist, wenn hier eine quasi wissenschaftliche Arbeit abgeliefert wird, und die Details dann so wenig wichtig sind, dass man nicht selbst nach “belastbaren Belegen” für einfache, technische Tatsachen sucht. Das soll jetzt nicht so böse rüberkommen wie es klingt. Aber entweder will man wissenschaftliche Sachverhalte darstellen und muss sich dann auch mit wissenschaftlichen Standards messen lassen – oder man belässt es bei der allgemeinen Darstellung: der PCR-Test ist nicht für das geeignet, für was er missbraucht wird. Ohne PCR-Test ist die ganze Pandemie weg wie ein böser Spuk. Und das wäre natürlich sehr zu hoffen.


        Lieber Albrecht,
        Sie sagten, dass nur Primersonden angewendet werden, auf das Vorhandensein der Gensequenz selbst aber nicht geprüft wird. Ich bat Sie, dass zu unterlegen, unter anderem mit belastbaren Quellen oder auch mit eigenem wissenschaftlichen Beweis. Wenden Sie also wissenschaftliche Ansprüche auch auf sich selbst an. Videoquellen genügen dafür nicht. Ungeachtet der Tatsache, dass ich Markus Fiedlers Arbeit sehr schätze.
        Grüße, Ped

      2. Und noch das: ich kann immerhin das Missverständnis aufklären, warum es in den Beschreibungen immer so klingt, wie wenn das Amplikon definiert wäre
        Das liegt einfach daran, dass man bei der Beschreibung des PCR-Verfahrens idR davon ausgeht, dass sich die Primer an die RICHTIGE Gensequenz anlagern. Und dann ist natürlich das Amplikon definiert und das richtige. Aber das Problem kommt dann, wenn in der Gemischelei nicht nur die richtige Gensequenz drin ist, sondern auch andere Gensequenzen, die zufällig auch passende Andockstellen für die zwei Primer haben. Und bei diesen falschen Gensequenzen liegt sehr wahrscheinlich eine ganz andere Sequenz zwischen den Primer-Andockstellen. Und dann wird eben diese Sequenz als Amplikon vervielfältigt. Jetzt klarer?
        Wie Herr Fiedler ausführt, erhält man dann bei einer Kontroll-Elektrophorese anstatt einem Bande viele Banden für verschieden lange Amplikons und hat damit den Beleg, dass etwas schiefgegangen sit – eine Kontrolle, die man offensichtlich bei dem Drosten-PCR eben nicht durchführt.

        Hier die ausführliche Darstellung durch Hr. Fiedler und mit Peter (Biochemiker)

        http://wikihausen.de/2021/01/06/corona-pcr-test-absichtlich-fehlerhaft-gestaltet-von-drosten-et-al-wikihausen-im-interview/

        und hier noch ein “Nachklapp” dazu

        http://wikihausen.de/2021/01/18/biontech-impfstoff-bnt162c2-fuer-gentherapie-drosten-pcr-fehlerhaft-nachklapp-wikihausen/


        Damit lässt sich etwas anfangen, danke.
        Grüße, Ped

  8. Ich bin vollständig schockiert: also nicht nur (mathematische) Simulationen und Modelle von Zusammenhänge werden benutzt, sondern sogar Simulationen und Modell von physischen Entitäten (Viren) um uns zu verblöden und zu verarschen.

    Damit schießt sich Wissenschaft endgültig in Richtung Phantasmagorien und Quacksalberei ab.

    Eine klasse Arbeit, Ped. Das ist ja fast schon eine Dissertation.

    Noch ein paar Hinweise von mir:

    durch die RT wird der Test nochmal zusätzlich fehlerhaft, da die RT prinzipiell sehr fehleranfällig ist.

    Und es werden gar nicht nach den Gensequenzen der Amplikons gesucht, wie aus dem Text soweit ich verstanden habe behauptet wird. Das Amplikon ist sozusagen nur das, was die “Masse” bei der Vervielfältigung liefert. Tatsächlich gesucht wird NUR die Sequenz, die von den Primern codiert wird. Die Primer docken auf dem Strang an und der Bereich Primer + Amplikon wird dupliziert. Aber das Amplikon selbst ist undefiniert und kann sonstwas sein. Herr Fiedler weist darauf hin, dass man deshalb per Elektrophorese einen Test durchführen muss, ob das vervielfältige Segment von der Anazahl der Basenpaare eigentlich plausibel ist – und ob insbesonder auch nur ein einziges Amplikon vervielfältigt wurde. Dieser zwingend notwendige Plausibilitätstest wird beim Drosten-PCR routinemäßig NICHT durchgeführt.

    Die zwei Primer sind zusammen so zwischen 40 und 60 Basenpaare lang. Nur diese wenigen Basenpaare werden (bei korrekter Anlagerung, vorausgesetzt) überhaupt wirklich überprüft und damit auch nachgewiesen.

    http://wikihausen.de/2021/01/06/corona-pcr-test-absichtlich-fehlerhaft-gestaltet-von-drosten-et-al-wikihausen-im-interview/

    1. @Albrecht! …. Sie sind aber wieder direkt!!!!
      “…. beim Drosten PCR” wird gar nichts “routinemäßig” durchgeführt!
      Der hat das Procedere mit der Nasenbuhlerei noch nicht mal live erlebt!
      Und ob “Frisuren” und “Friseur” bei Drosten “plausibel sind”…. darf bezweifelt werden!
      Vor wenigen Jahrhunderten wäre ein solcher Scharlatan auf einem 3 Meter hohen Holzhaufen ….
      Aber es soll ja anders kommen:
      Man “bombt” die Gesellschaften genau in diese Zeit zurück. Also wären doch auch solche Maßnahmen erlaubt, oder….?
      Ach, wie gerne wäre ich “Tilman Ulenspiegel” und dürfte ALLES ….

      LG!

      Gerhard

  9. Es ist bemerkenswert wie detailliert Sie das ausgearbeitet haben Ped. Alle Achtung !

    Allerdings, ich bin ich mir nicht so sicher ob bei dieser Arbeit, die gewiss Zeit und Mühe gekosten hat, Aufwand und Nutzen in einem Verhältnis stehen – ob man damit weitere Menschen erreichen kann.
    Denn die Antwort von Frau Merkel auf der BPK, auf die Frage von Herrn Reitschuster auf welcher Grundlage sie / die Regierung entscheidet, war doch unmissverständlich:

    “Letztendlich ist das eine politische Entscheidung.”

    Was per Politik – Definition heißt :
    “Methode, Art und Weise, bestimmte eigene Vorstellungen gegen andere Interessen durchzusetzen”

    Das heißt es sind Entscheidungen nicht (unbedingt) auf sachlicher Grundlage, sondern es sind Machtentscheidungen . Es geht hier nicht um Fakten!

    Wenn wir dem folgen, stellt sich die Frage wer gibt ihr die Macht ? Wer entscheidet über die Machtfrage in unseren “demokratischen” Gesellschaften ?
    Es sind die Eigentümer der großen Medien, sie entscheiden über die erzeugten Realitäten.
    Allein der Umstand, dass wir für die ÖR zahlen, macht uns jedoch nicht zu Eigentümern. Das ist offensichtlich. Hier sind wir nur Schuldknechte.
    Ergo
    Die mediale Machtstruktur zu durchbrechen hieße zuerst, die ÖR in ihrer jetzigen Form DEUTLICHST in Frage zu stellen, um sie zu Reformieren.
    In Hinblick darauf ist es für mich – nach wie vor – völlig unverständlich, dass es für Initiativen wie “Rundfunk – Frei” von Olaf Kretschmann nur einen vergleichsweise bescheidenen Zulauf von 150 Tsd unterstützern gibt.
    Ich begreife es einfach nicht.

    Gibt es einen besonderen Grund dafür, warum Sie Ped, diese Seite unter “empfohlene Blog’s” nicht aufführen ?

    1. Werter Anarchist,

      zu Frau Merkel:
      und ihre ” Grundentscheidungen” die über das Wissenschaftliche hinausragen und sie, wie sie öffentlich auch sagte, letztendlich bei anderer Ansicht alleine entscheidet. Somit sind die Regierungsentscheidungen und veranlassten Maßnahmen politisch motiviert und sie verlässt sich nur auf die Wissenschaftler im Ergebnis, die ihr wenn gedanklich genehm sind.

      Im Kern steht doch Wissenschaft mit Rang und Namen gegen diese Frau und die Regierung und deren Entscheidungen.
      Da steht sie auch nicht alleine da, das trifft so ziemlich alle Regierungen, die dem Lockdown das Wort reden.

      Genau deswegen übergeht sie einfach das Wissenschaftliche, weil da mehr und mehr ein D-Zug auf sie zurollt und sich so eine Argumentation zurechtlegen hat, um weiterhin das Volk schlafend zu halten.

      Genauso wird sie agieren bei immer mehr zunehmenden Gerichtsentscheiden gegen die Maßnahmen im Nachgang oder gar gegen die Regierung selbst. Erst versucht man die zu revidieren, gelingt das nicht, kommt das ignorieren. ( Siehe Österreich)

      Zum ÖR Rundfunk:

      dieser ist doch nicht das Problem, das Problem dessen ist das über die letzten 20 Jahre bald zunehmende Austauschen seiner Direktoren und Intendanten, die transatlantiker sind zum einen, zum anderen dadurch der ÖR zu den Sprachröhren der Politik geworden ist. Die Nähe zur Politik ist ja nicht von der Hand zu weisen.
      Wer sitzt in den Aufsichtsgremien, wer sind die Personen in den Programmräten, besonders ZDF?

      Da ist ein Filz entstanden, der so eigentlich hätte nicht entstehen können. Es gibt den Rundfunkstaatsvertrag, der doch klar benennt, was geht und was garnicht geht.
      Aber wo kein Kläger, da auch kein Richter. Und selbst bei mittlerweile tausenden von Programmbeschweren, das Selbe wie oben beschrieben. Ignorieren!
      Nichts hat irgendeine Konsequenz bei allen schweren Fehlverhalten und Vergehen.

      Glaubst Du wirklich, es würde besser werden, gäbe es den ÖR nicht mehr?
      Was stellst Du dir denn anstelle vor, nur noch private Sender?
      Die werden es bestimmt viel viel besser machen, oder?
      Ein hoch auf Pro 7, RTL, Sat 1, die berichten ja schon seit Ewigkeiten absolut neutral und deren Recherche ist ein Traum, was die so an Wahrheit liefern. 🙂

      Der ÖR muss bleiben, er muss nur wieder hin zu seinem eigentlichen Auftrag gebracht werden.
      Der muss genauso komplett neu strukturiert werden, wie unser Parteiensystem und Parlament und unsere Demokratie. Nämlich so, das so ein Mist wie jetzt absolut sichtbar, aber nicht erst seit Jetzt, nicht mehr passieren kann.

      Der ÖR macht im Grunde das Programm, was der Zahlende und Gesetze bestimmen, nicht andersrum.
      Private werden das NIE tun. Die Zahle dort heißen Industrie und Konzerne in Form von Werbung. Wessen Lied singen die wohl?

      Es ist eben so, auf ganzer Linie und überall, entfilzen, entfilzen und nochmal entfilzen.

      Eine große Aufgabe, die da vor uns Allen liegt.

      Grüße, Tommi

      1. Kleiner Nachtrag dann zum Artikelthema, nämlich der Betrug mit dem Test; und da schließt sich der Kreis auch, Genehme Wissenschaft die den kreiert, Politik, die den auf Biegen und Brechen anwenden lässt, Medien, ÖR voran, die die Bevölkerung in Angst und Panik versetzt und im Schockzustand und Unwissenheit hält.
        Da kann man mal sehen, mit welch einfachen Mitteln man ein Land regieren kann. 🙂
        Das alles ist aber nicht vom Himmel gefallen, das bedurfte Zeit und lange Vorbereitung und natürlich ein Volk, das die ganze Zeit schon still hielt. WIR alle haben geschlafen, auch die jetzt aufgewachten und haben die Angelegenheit passieren lassen sehenden Auges.
        Das ist fast so, als würden man in freudiger Erwartung und ein Lied singend in eine laufende Kreissäge springen.
        Jetzt ist das Kind im Brunnen und wir alle haben keine Lust als Kinder dieses Landes im Brunnen zu ersaufen.

        Also nochmal, entfilzen und den Mist nicht auch noch weiter mittragen.

      2. Hallo Tommi, vielen Dank für Deine ausführliche Antwort.

        Ich möchte nur kurz auf ein Paar von Dir genannte Punkte eingehen. Auch wenn die öR ja hier nicht das Thema des Artikels sind, sind sie dennoch ein Grundproblem und Hauptverursacher der Situation in der wir uns derzeit befinden. Hauptverursacher dafür, dass die Mehrheit nicht erkennt welches Spiel gespielt wird. Und das sich unsere Gesellschaft gegen die Angriffe der Multis offenbar nich wehren kann.

        Zunächst, ich habe nicht geschrieben, dass ich den öR abschaffen möchte.
        Das ist auch bei Rundfunk-Frei nicht das Ziel. Es geht mehr um das bezahl Model.

        Ich habe die Argumente die Du nennst auch schon des öfteren gehört. Nur kann ich mich Ihnen nicht anschließen, da sie voller Widersprüche sind und m.M. ignorieren, dass es sich hier um etwas grundsätzliches handelt. Es handelt sich um eine Machstruktur Tommi, mit guten Worten ändert sich da garnichts. Nur mit massivem Druck ! Den müssen aber die Menschen aufbauen, indem sie sich einig werden und engagieren. Eine funktionierende Medienlandschaft ist von konstitutiver Bedeutung für die Bewußtseinsbildung einer Gesellschaft.

        Es ist aus meiner Sicht nicht so bedeutsam WIE die parteipolitischen Verfilzungen entstanden sind und ob das hätte entstehen können / sollen oder nicht. Entscheidend ist das was ist. Und das sehen wir.

        Ich neige nicht dazu die Schuld grundsätzlich bei einzelnen Akteuren zu suchen, würde vielmehr versuchen die Struktur so anzupassen das ein Missbrauch begrenzt wird.

        Was die „privaten“ betrifft, so finde ich nicht das Ped hier -als privater- schlecht schreibt, auch kann ich das nicht feststellen bei anderen altern. Plattformen wie z. B. Ken FM. Also, so einfach scheint es nicht zu sein.

        Mir fällt auf, dass Du Deine Argumente auf die „geringere Übel Methode“ aufbaust.
        Indem Du die scheinbar schlechtere Alternative der „privaten“ als Abschreckung einsetzt, um
        Den öR als einzig plausible (denkbare) Lösung erscheinen zu lassen. :

        „Glaubst Du wirklich, es würde besser werden, gäbe es den ÖR nicht mehr?
        Was stellst Du dir denn anstelle vor, nur noch private Sender?“

        Das sind suggestiv Fragen Tommi, Propaganda eben.
        Wenn ich mich recht erinnere, hatte J. Fischer auf diese Weise damals den Jugoslawien Krieg medial gerechtfertigt, den Kriegseinsatz als unvermeidlich verkaufte, indem er die Existenz von Konzentrationslagern dort ins Spiel brachte . (Die es jedoch nicht gab) Übele Manipulation der Öffentlichkeit.

        Immer wenn uns jemand suggeriert es gäbe nur zwei Lösungen, und man müsse doch das geringere Übel nehmen, dann ist was Faul Tommi! Es gibt (fast) immer viele Möglichkeiten. Aber natürlich nur dann, wenn das Meinungsspektrum und damit die Denkviefalt nicht eingeschränkt wird.

        Nun gut, da wir ja vom Filz sprachen, lies doch einfach Deinen Kommentar nocheinmal und setze statt „öR“ das Wort „Mafia“ ein. Vielleicht verstehst. Du mich dann?

        Findest Du Gehälter von 300000 – 400000 EUR p.a. ok? Wenn Du weist das die alleinstehende Rentnerin mit 900 EUR Monatsrente diesen Luxus finanzieren muss? Den Gang zum Sozialamt scheut, weil sie ihre Würde wahren will?
        Schau doch einfach mal rein dort und lies die Argumente.
        https://rundfunk-frei.de/

        Es gibt kein richtiges Leben im Falschen.

        1. Hallo Anarchist,

          obwohl oder weil ich von Anarchisten nach eigener Einschätzung weit entfernt mich bewege, bewegen mich deine Beiträge zu einer Antwort.
          Warum?
          Weil ich Dir uneingeschränkt zustimme! Du siehst das, Schreck lass nach, vollkommen so wie ich auch, dabei bin ich ein uralter Knacker mit eher konservativen Ansichten.
          Schon daran lässt sich unschwer erkennen, wie viel in D inzwischen absolut falsch läuft.

          Meinen herzlichen Dank an Ped für den sehr informativen Beitrag will ich nicht vergessen!

          1. Hallo Roland,
            Wenn das Bild von Dir aktuell ist, find ich den „alten Knacker“ etwas übertrieben
            Aber manchmal fühle ich mich auch so, als 68er Jahrgang.
            Danke jedenfalls für Deine Antwort.

            Es gibt sicher einige Leute die Anarchisten sind, ohne sich dessen Bewusst zu sein oder sich als solche zu bezeichnen. Der Begriff ist aktuell negativ belegt/verseucht, und das hat seine Gründe.
            Diese liegen allerdings nicht – wie offiziell dargestellt – darin , das es perse schlecht für den Menschen wäre, sondern vielmehr darin, dass libertäre Bewegungen schon immer eine Gefahr für Machtstrukturen waren.

            Ich verstehe Anarchie also im philosophischen Sinne als:
            „gesellschaftlicher Zustand, in dem eine minimale Gewaltausübung durch Institutionen und maximale Selbstverantwortung des Einzelnen vorherrscht“

            Um diese Selbstverantwortung übernehmen zu können muß der Mensch wachsen können, das geht prinzipiell nicht bei dauerhafter – durch wen auch immer – Fremdbestimmung.

            Das entspricht im Grunde einem humanistischen Ideal und es heißt nicht dass es keine Autoritären und damit Machtgefüge gibt. Sie bleiben jedoch auf das notwendige Maß beschränkt und sind meist von natürlichem Charakter (so wie Eltern für ihre Kinder o. Alte für Junge Menschen) und wirken stets konstruktiv.
            Es hat in vielen Kulturen und Religionen diese Bewegungen gegeben.
            Bei den Christen waren es z. B. die Gnostiker, die Waldenser, die Katharer. Wegen letzteren wurde damals die Inquisition eingeführt, anders wurde man ihnen nicht „Herr“. In Asien der Daoismus. usw.
            Falls Du Dich interessierst kannst Du im Netz „Freiheit pur“ H. Stowasser als PDF kostenlos runterladen.
            Gruß

        2. Das Problem beginnt doch schon da, wenn in den Schulen “Sich-vor-Fake-News-Schützen” und “Verschwörungstheorie-Ablehnen” gelehrt wird.

          Aber ich halte das tatsächlich langsam für ein geistige Problem: die Menschen suchen nach “Wahrheiten”.
          Und was gesucht, “nachgefragt” wird, wird auch geliefert!

          Ich entsinnen mich noch gut, wie man (also zumindest in meiner Umgebung) in den 1960iger-, 1970iger-Jahren sehr gut damit leben konnte, alles in Frage zu stellen, alles Gewisse zu zertrümmern.

          Heute haben wir das Gegenteil: Ungewissheit muss ausgemerzt werden. Und auf dieser Welt gibt es dazu nur ein Mittel: Autoritäten schaffen die dann Dogmen setzen.

          Anderer “Gewissheiten” gibt es in diesem Kosmos leider nicht. Also nimmt man halt die, weil in der Ungewissheit leben anscheinend unerträglich ist.

  10. Lieber Ped!
    Dieser, Ihr obiger Artikel, ist wieder eine wahre Fleißarbeit! In der Schule (Präsenzunterricht!) bekämen Sie von mir, wäre ich “Lehrer”, eine “1+”. Besser geht es nicht. Ehrlich und ganz ohne Schleim!
    Gebe zu- habe schon einige Zeit gebraucht, um Ihren Artikel “zu verarbeiten”.

    Aber nun zu meiner Antwort:
    So will ich mich auf Ihr Vorwort beschränken.
    Ausgehend von dem Begriff “… falsche Tatsachen vorspiegeln …” scheint es zuzutreffen:
    Drosten predigt etwas, was er wie Sauerbier anpreisen muss. Den “PCR- Test”. Nun ist, so glaube ich- für einen Volljuristen, der ich nicht bin- diese “Tatsache” strafbewehrt. Also, “Betrug”.
    Im Fach “Infektion und Desinfektion” bin ich aus meiner beruflichen Vergangenheit ein wenig “bewandert”. Deshalb erscheint mir die massive Weigerung von Großteilen des med. Personals, incl. Ärzte, (ca. 70%. Quelle: “Sächsischer Hausärzteverband”) verständlich. Es reicht sogar soweit (wie mir Ex- Kolleginnen und Kollegen berichteten), das “Krankmeldungen” aus dem Stegreif erfolgten.
    Im Laufband von “ntv” wird gejammert, das “… viele Kliniken an die Grenzen ihrer Kapazität stoßen…” und aus anderer Quelle hört sich das so an:”…. der Kassenärztliche Verband warnt vor einer Pleitewelle vieler Kliniken im Frühjahr 2021…” (Radio Lausitz, Görlitz). Ja, WAS tun, wenn sich das Personal dezimiert und “krank meldet”? Und, was hat das mit der Betrugsmasche vom “PCR- Test” zu tun?

    Viel!
    Wer diese “Masche” bisher durchschaut hat ist- das medizinische Personal!!!!!
    Um einer massiven Veröffentlichung dieses “unerwünschten Ereignisses” entgegen zu wirken werden solche Revolverblätter wie “BILD” in die Spur geschickt. Die Bilder und “Informationen” aus den getürkten (Ja!!!!) Schlagzeilen gelangen zu den Wegelagerern diverser Fernsehsender.
    Vom eigentlichem Grund für diese “Schlagzeilen” wird mehr oder weniger “offen” abgelenkt.

    Mehr noch:
    Grenzpendler unserer östlichen Nachbarländer, wirtschaftlich unverzichtbar (weil die illegal “Eingewanderten” eben nun doch nicht “Fachkräfte sind …), berufen sich in Prag z.B. (Nachricht heute: “Radio PSR”) über ihren “Verband der Genzpendler” auf ihre Gewerkschaftlichen Rechte und fordern, “… das diese Drangsalierung durch deutschen Behörden im Sinne des ‘Gesundheitsschutzes’ ein sofortiges Ende findet. Sehr viele Familien und Bürger Tschechiens verdienen sich ihren Lebensunterhalt im deutschen Grenzgebiet oder leben in Deutschland. Das Erschweren, zum Arbeitsplatz zu gelangen ist nicht dem Europäischen Gedanken dienlich!” (Sinngemäß, fast wörtlich)

    Was tut die Sächsische Landesregierung? Bietet “am Arbeitsplatz zwei Mal wöchentlich (1) einen ‘PCR- Test’ kostenlos an.” Wie großzügig, sich massiv aus der Nase Sputum (?) abnehmen zu lassen …
    (1)
    Warum muss jede Woche zwei Mal “getestet werden”???? Da habe ich im Studium in Leipzig offenbar gefehlt …
    Da dieses “Testverfahren” sinnfrei IST, überhaupt KEINEN RÜCKSCHLUSS auf eine (jegliche!) Infektion durch Virenstämme zulässt, ist es umso verwerflicher von verantwortlichen “Politiker*innen”, Pharmabonzen und Pharmalobbyisten ins Horn zu tuten nur um ihre Bankkonten zu füllen.
    Frage mich ernsthaft, ob nicht Drosten oder Spahn zu den “10 reichsten ‘Männern’- na ja, “Spahn…”- der Welt in der Corona- Krise zählen.” (Radio “PSR”).

    Mein Eindruck ist derzeit, das es “Wetterleuchtet”. Es scheinen allmählich einzelne, wenn auch “Regionale-“, Rundfunkmedien “auszuscheren”…. eine kleiner Hoffnungsschimmer, der Aufklärung.

    Voller Zuversicht!

    Gerhard Käntzler

  11. “Der muss genauso komplett neu strukturiert werden, wie unser Parteiensystem und Parlament und unsere Demokratie. ”

    Respekt, @Tommi!!!
    Lese mal meinen Beitrag… bin zwar nicht so weit gegangen wie Du, weil ich “die Einschläge” anders verortet habe (stammt von “Clausewitz”!), aber das ist auf jeden Fall des Wunsches weiser Schluss!
    Na, hoffen wir, das uns diese Bande nicht noch mit “Briefwahl” oder “Digitaler Wahl” vollständig entmündigen will. Dann wird es wirklich hart, so hoffe ich ….

    LG (“Du”… weil ich alter Knacker es anbiete)

    Gerhard

    1. Lieber Gerhard, Du alter
      Knacker 😉
      Angenommen, da ältere so etwas ja anbieten dürfen und man sich als jüngerer (57) geehrt fühlen sollte.

      Auf dass es bei Dir noch nicht allzusehr knackt und du locker auch die 99 erreichst, wie meine Oma. Die wollte die 100 überbieten, wie sie immer sagte, aber da war dann die Lebenskraft doch kurz vor dem Ziel erschöpft. Schlief letztlich fast Gesund ein, weil das Herz nicht mehr wollte.
      Zwei Kriege waren auch ihr Schicksal und nichts blieb erspart.
      Heimatvertrieben, Angehörige im Krieg verloren und letztlich doch stark aus allem rausgekommen. Alte Landwirtin eben und das Leben ganz schön oft schwer war, aber im Leben eben auch nichts zu schwer sein kann, was man nicht selber angeht in der Not. Das zu wissen und mir mit auf dem Weg gegeben, lässt mich hoffen. So schwer haben wir es noch nicht. 😉
      Um die Geschichte noch zu runden, Opa war in der 6. Armee und im Kessel, danach Gefangenschaft. Kam ’53 selbständig zurück und wurde nicht freigekauft durch die Regierung.
      Wie man den Gulag und den weiten Weg zur damaligen Zeit zurück schaffte, blieb sein Geheimnis. Ganz ehrlich, ich möchte es auch nicht wissen. Weiß nur, er war einfacher Lanzer.

      Wenn wir schon bei Clausewitz sind:

      „Der Krieg ist eine bloße Fortsetzung der Politik mit anderen Mitteln.“

      Ich kann nur sagen, Kriege müssen endlich aufhören in dieser Welt und der Krieg gegen ein vermeintliches Virus, wird auch nur mehr Kriegsopfer nach sich ziehen, als anderes.

      Um auf Dein ” des Wunsches weiser Schluss” zurück zu kommen; hier ist nicht der Wunsch Vater meines Gedankens, eher das Wissen um die Tatsache, dass die Struktur vollkommen die Festigkeit und Funktion verloren hat. Das, weil das Konstrukt “Demokratie” in der Form, wie wir sie haben, schon von Beginn an einen Strukturfehler hatte.
      Das ermöglichte unter Anderem, dass die Struktur mehr und mehr von innen her aufweichte und jetzt beginnt sich sichtbar aufzulösen.
      Es wird sich zeigen, ob unsere Gesellschaft noch so stark ist wie unsere Großeltern, um von innen her die Struktur wieder zu festigen.
      Es wird wohl nur gehen, bauen wir alle ein stabiles inneres neues Gerüst, ohne Konstruktionsfehler. Zumindest mit weniger anfänglichen Fehlern und hin zu einer Weiterführung und Verbesserung, schleichen sich Fehler ein, oder sind anfänglich Fehler übersehen worden.
      Das alles geht nur im ständigen gesellschaftlichen Dialog. Da müssen alle mitmachen, den jeder ist darin gefordert, will man als Gesellschaft nicht über den Tisch gezogen werden.
      Da fangen wir doch zukünftig einfach bei der Bildung an. 😉

      Ich befürchte, wenn nicht vorher das Corona-Neue Weltordnung-Kartenhaus zusammenbricht, wirst Du Recht behalten mit der Wahl Verschiebung, oder Briefwahl, Digitalwahl. Man wird versuchen sich die Macht politisch zu erhalten. Da wird Wahlbetrug noch ein Thema werden, zumindest tun sich da Möglichkeiten auf. Ich traue mittlerweile der Bagage alles zu.

      Es stimmt, dann wird es hart…. ich hoffe nicht, das es dann ernsthaft radikal hart wird, sonst Clausewitz und Kriege sind keine Lösung. 🙂

  12. Ihrer Analyse zum PCR Test, insbesondere ihres Fazits, im Eingedenken an die Ansammlung von nicht nachvollziehbaren Konsequenzen die dieser Test nach sich zieht, ist in höchstem Maße zuzustimmen. So detailreich wie bei Ihnen konnte man diese Zusammenfassung des Betruges noch nicht einsehen. Aber man konnte ihn vorhersehen. “Ohne PCR Test keine Pandemie”. In diesem Bewusstsein erlebe ich, und viele andere, nun seit einem Jahr diese Mauer der Borniertheit. Deshalb empfinde ich es als sehr traurig, das ihre umfangreiche Recherche ein weiteres Mal abprallen wird an der Engstirnigkeit und Korruptheit derer die sich selbst verleugnen. Die Politik hat es nach langer Vorarbeit geschafft die Institutionen, deren Existensen verknüpft waren mit Wissenschaft, Recht und Aufklärung, zu einem kadavergehorsamen Einerlei zu gestalten deren einzige Aufgabe zu sein scheint im falschen Leben das richtige zu sehen.

  13. Hallo Ped,
    hab gerade ein Video gefunden das am 22.01.2021 live gesendet wurde,darin geht es unter anderem mit Rainer Füllmich neben anderen Teilnehmern insgesamt um die Inhalte des Serums—-https://www.youtube.com/watch?v=vca1uVerXGQ&feature=youtu.be—-
    Man kann davon ausgehen das sämtliche Institute inklusive WHO in Verbindung mit der ILO als Versicherung (2018 sind die Versicherungsbedingungen geändert worden–alle ständige Davos-Beratungsmitglieder ) als große Schwindelorganisationen die die Welt beherrschen wollen in keiner Weise Glaubwürdig daher kommen,oder anders große Verbrecherorganisationen sind——–keiner soll sich Impfen lassen,das ist der dringende Aufruf-bis der wahre Hintergrund auf den Tisch gelegt wird

  14. “Über einen Test, mit dem man eine Pandemie herbeizauberte.”

    Erinnert mich an “Zauber- Peter” auf Schloss Kuckukstein bei Liebstadt in der Sächsischen Schweiz und im “Fernsehen der DDR”…. sorry, Freunde westlich!
    Dieser Mann lebt heute auf einer sonnigen Insel…. weit weg. Dem Künstler geht es peripher am umtuchten Hinterteil vorbei! Richtig so! Ob der auch mit “FFP 2” (von Frau Södolf …) rumrennt?

    Habe kürzlich gelesen (wo?), das es “weltweit 500 Corona- Testverfahren” gäbe. Ob es so ist, egal.
    Was mich aber umtreibt ist die Frage, wenn es nicht nur den allerheiligsten “PCR- Test” gibt, worauf fußt dann die Begründung für die “Ausrufung einer Pandemie”??????

    Warum, und ausgerechnet, springen die Israelis, welche wirklich über ein exzellentes Gesundheitssystem (na ja…. habe selbst in Netanya im “Emergecy- Room” gelegen …) verfügen, auf diesen “Zug” der WHO auf? Mir unverständlich.
    Es kursierte mal das Gerücht (?), das “die WHO Weißrussland” (“Belarus”… ein Traktor!) Millionen Dollar versprochen hätte, nur das Lukaschenko die “Pandemie” ausrufen möge. Er lehnte ab …
    Würde mich, und viele andere hier, sicher zur Erkenntnis führen,
    Vielleicht weiß ein kluger Kopf hier bei “Ped” etwas mehr.
    Ansonsten- frage ich mich, ob ich mich “verlesen habe” oder wirklich zu schnell “alt werde” ….

    G. Käntzler


    Zu Weißrussland: https://www.cashkurs.com/beitrag/weissrussland-iwf-und-weltbank-knuepfen-nothilfekredite-an-harte-lockdown-massnahmen/

  15. Lieber Dr. Ped, vielen Dank für diesen umfassenden Artikel über die Wunderwelt der PCR Tests, Herr Mullins wäre stolz auf sie.

    Aber, das C.Drosten Politiker und Behörden betrügt halte ich für ausgeschlossen, dasselbe krumme Ding gabs ja schonmal als Testlauf bei der Schweinegrippe, da klappte das noch nicht so ganz.. Ich hab eher das Gefühl das war eine fruchtbare Zusammenarbeit die zufälligerweise eine gewisse Ähnlichkeit mit Narrativen des WEF haben.

    Deswegen finde ich solche Artikel zwar hilfreich, aber eigentlich wissen das die die es wissen wollen eh schon, und die anderen kann man damit auch nicht überzeugen. Ich glaube wir sollten eher versuchen die Geschichte die dahinter steckt herauszuarbeiten, und den ablenkenden Coronakram soweit es geht ignorieren. Nicht umsonst fragen ja viele Coronagläubige wie es sein kann das das über soviele Staaten hinweg funktioniert, das ist das was ich als Coronaungläubiger ja auch gerne herausfinden möchte. Das Dumme ist nur dort kann man nicht so “einfach” mit Formeln arbeiten. Einige Erklärungen findet man natürlich bei Herrn Fromm in “Die Furcht vor der Freiheit”, aber diese Gedanken muss man erstmal auch entsprechend umsetzen auf das Geschehen rund um die “Pandemie”.

    Aber egal, das soll den Artikel nicht schlecht machen sondern nur ihn einordnen. Und wenn mir jetzt noch jemand sagen kann mit wievielen Zyklen man Kartoffeln kocht 😉

  16. Das ist der Hammer und darf nicht untergehen denn wie wir alle breitflächig verarscht werden kann man nur an den doch immer wieder kurz aufflackernden, kleinsten Wahrheits-Lichtblitzen sehen:

    “Ermittlungen lassen das Rechts-Narrativ bröckeln

    Geleaked wurde das Papier offenbar von einem BKA-Beamten, der die Brisanz des Schreibens erkannt hat. Der Bericht widerspricht dem von etablierter Politik und vielen Medien gezeichneten Bild einer rechtslastigen, gewalt-affinen Gruppierung, das seit Monaten in der Öffentlichkeit von der Querdenken-Bewegung präsentiert wird. Gewalttätig und gefährlich sind auf den Anti-Maßnahmen-Protesten allerdings, so der Kern der BKA-Analyse, vor allem die linken Gegendemonstranten. Und: Von einer Unterwanderung der Bewegung durch Rechtsextremisten kann laut BKA-Ermittlungen nicht die Rede sein.”

    https://www.nordkurier.de/politik-und-wirtschaft/linke-gegner-sind-das-gefaehrlichste-an-querdenken-demos-2542193201.html

    Ich möchte den Text etwas korrigieren:

    Gewalttätig und gefährlich sind auf den Anti-Maßnahmen-Protesten allerdings, so der Kern der BKA-Analyse, vor allem die PSEUDOlinken Gegendemonstranten.

    Denn wer kann ernthaft “links” eingestellt sein, und dabei gegen legitimen politischen Protest von Mitmenschen demonstrieren? Wer kann den Sinn und das Ziel des Demonstrationsrechtes dermaßen missverstehen? Was sich da selbst für links hält ist durch und durch politisch rechts: autoritätshörig, obrigskeitshörig, repressiv, antidemokratisch und dazu GEWALTTÄTIG gegen Mitmenschen! Das ist Rechts bis ins Mark – ob das die Protagonisten wahr haben wollen oder nicht.

    Und das alles wird uns gezielt verheimlicht, vielmehr arbeiten alle, insbesondere die ganze Pseudolinke, Regierung, Konzern-Medien, Partei-ÖRR an einem einheitlichen Bild: die bösen rechten Querdenken-Verschwörungstheorien-Anhänger müssen an allen Fronten bekämpft werden.

    Denke man noch an das pseudolinke “ZeroCovid”-Faschismus-Pamphlet, so sollten wirklich so langsam allen die Augen aufgehen: was uns als “liinks” verkauft wird, ist durch und durch verrottet und verfault, nichts weiter als ein Herrschaftsinstrument zur Verhinderung jeglicher Veränderung zum besseren.

    1. “Denn wer kann ernthaft “links” eingestellt sein, und dabei gegen legitimen politischen Protest von Mitmenschen demonstrieren?”

      Sehr richtig, das widerspricht und widersprach schon immer dem Grundgedanken linksorientierter Menschen. Der älteste Beleg dafür ist die Sitzordnung der französischen Abgeordnetenkammer von 1814. Vom Präsidenten aus betrachtet, saßen auf der linken Seite die Parteien, die für soziale Gerechtigkeit eintraten. Auf der rechten Seite die konservativen, die die Monarchie und die Privilegien für Reiche erhalten wollten.

      Die sogenannten “Eliten” sind dreist genug, uns ihre “SA-Schlägertrupps” als Linke zu verkaufen. Das ist eine Lüge! Die antifa ist in etwa so links wie die grünen, die spd oder Jack the Ripper.

  17. Für alle, die die 36. Sitzung des Corona-Ausschusses noch nicht gesehen haben:

    Ganz am Anfang der Sitzung werden Bilder von Geimpften gezeigt, die unter schrecklichen Nebenwirkungen leiden. Eine deutlichere Warnung vor dieser uns aufgedrängten Impfung kann man sich kaum vorstellen…

    () https://youtu.be/GyOrXnx5lUQ?t=1662

    Wer dann immer noch glaubt, die Impfung, die in Wirklichkeit ein genetischer Eingriff ist, sei harmlos, befindet sich in einem gefährlichen Irrtum. Tatsächlich erleben wir einen global angelegten experimentalmedizinischen Test eines genetischen Eingriffs, wobei dem Anschein nach die gesamte Menschheit als Versuchsobjekt missbraucht werden soll. Das hätte sich nicht einmal ein “Josef Mengele” getraut.

    Man kann nur hoffen, dass die Drahtzieher dieser Impfkampagne, die am Ende u.U. viele Millionen Tote auf ihrem Gewissen haben werden, die Strafe erhalten, die das Gesetz für derart schändliche Vergehen vorsieht.

    Was den PCR-Test angeht, so titelte die “Achse des Guten” am 22.01.2021, aus meiner Sicht etwas reißerisch…

    WHO beendet Epidemische Lage von Nationaler Bedeutung

    https://www.achgut.com/artikel/who_beendet_epidemische_lage_von_nationaler_tragweite

    Tatsächlich hat die WHO ihre Empfehlung für die Anwendung des PCR-Tests angepasst.

    https://www.who.int/news/item/20-01-2021-who-information-notice-for-ivd-users-2020-05

    Neben dem Hinweis, dass die IFU (Anleitung/Instruction For Use) genau beachtet werden muss (was sich wohl von selbst versteht), ist wohl folgender Wortlaut der Empfehlung von Interesse:

    “Die WHO-Leitlinie Diagnostischer Tests für SARS-CoV-2 besagt, dass eine sorgfältige Interpretation schwach positiver Ergebnisse erforderlich ist (1). Die Zyklusschwelle (Ct), die zum Virusnachweis benötigt wird, ist umgekehrt proportional zur Viruslast des Patienten. Wenn die Testergebnisse nicht mit dem klinischen Bild übereinstimmen, sollte eine neue Probe entnommen und mit der gleichen oder einer anderen NAT-Technologie erneut getestet werden.

    Die WHO weist IVD-Anwender (IVD = In Vitro Diagnostik) darauf hin, dass die Krankheitsprävalenz den prädiktiven Wert der Testergebnisse verändert; mit abnehmender Krankheitsprävalenz steigt das Risiko eines falsch positiven Ergebnisses (2). Das bedeutet, dass die Wahrscheinlichkeit, dass eine Person mit einem positiven Ergebnis (SARS-CoV-2 nachgewiesen) tatsächlich mit SARS-CoV-2 infiziert ist, mit abnehmender Prävalenz sinkt, unabhängig von der behaupteten Spezifität.

    Die meisten PCR-Assays sind als Hilfsmittel für die Diagnose indiziert, daher müssen Gesundheitsdienstleister jedes Ergebnis in Kombination mit dem Zeitpunkt der Probenentnahme, dem Probentyp, den Assay-Spezifika, klinischen Beobachtungen, der Patientenanamnese, dem bestätigten Status etwaiger Kontakte und epidemiologischen Informationen berücksichtigen.” – (deepl)

  18. “Die irische Molekularbiologin und Immunologin, Prof Dr. Dolores Cahill, die auf einen beeindruckenden Lebenslauf zurückblicken kann”, hat vermutlich hier bei Ped gelesen, bevor sie wörtlich sagte:
    „Ich starte ein Projekt um den PCR-Test zu sequenzieren, da dieser gesamte Lockdown auf positiven PCR-Tests beruht. Doch in der diagnostischen Welt würden Sie niemals nur anhand einem Positiv oder Negativ eine Diagnose stellen. Genau genommen müssen Sie sequenzieren was die Testmessung ist und im Oktober 2020 hat man 1500 PCR-Tests sequenziert und alle stellten sich als Influenza A und B heraus. Die Gesetzgebung des Lockdowns und der sogenannten pandemischen und gesundheitlichen Notlage internationaler Tragweite basiert darauf, dass der Krankheitserreger COVID-19 ein Coronavirus ist. Was wir und ich persönlich tun werde ist die Sequenzierung der PCR, mit Einverständniserklärung von Menschen in Irland und Groß-Britannien. Wenn diese Sequenzen nicht Sars-Cov-2 sind, was nach meiner Auffassung eine biologische Unmöglichkeit ist.”
    Quelle:
    https://orbisnjus.com/2021/01/27/todesstoss-fuer-corona-pcr-test-regime-video/

    1. Wenn es so wäre, lieber @Dian, dann ist es doch nicht verwunderlich, das “die Zahl der an Influenza- Erkrankten seit 2020 stark rückläufig ist…” (ntv).
      War eigentlich schon vorher klar …

      Mal ganz profan, und von mir aus:
      In allen Jahrzehnten meines bisherigen Lebens kam es immer wieder mal vor, sich eine Grippe “einzufangen”. Kennt sicher jeder. Was wurde da getan? “Hausmittel” um Fieber abzubauen oder “Bombe”, Im schlimmsten Falle Krankenschein… für 14 Tage. Was war das- aus “heutigem Zeitverständnis”?:
      “Freiwillige Quarantäne”! Weil es mir dann oft so dreckig ging, das ich “das Bett hütete”. Auch klar, denke ich.

      Wenn ich im Dienst zu Hauspatienten musste, kam es oft (!) vor, das ich mir (und nicht nur ich!) “den “neuartigen Noro- Virus” eingefangen habe. Überhitzte Wohnungen, übelriechende Luft, Hygiene- Fehlanzeige,- aber den Tisch mit Beipackzetteln zahlreicher Medikamente vollliegen!
      Das Ergebnis wenige Tage danach war immer das gleiche: 24 Stunden körperlichen Totalausfall!
      Danach war alles vorbei.

      Wie sich schützen? OP- Handschuhe im Auto schon anziehen, Mit aufgesetzter OP- Maske das Haus betreten, Maske auflassen.
      Dann trudelten nach einigen Tagen die “ersten Beschwerden ein” (wegen den Masken …):
      Angehörige von Patienten beschwerten sich darüber, “… das die erkrankten Angehörigen durch unser Betreten der Wohnung mit Mundmaske (!) geängstigt (!) werden…”. (aus einem Weisungspapier, Rettungsdienst).

      Nun kann sich der geneigte Leser vorstellen, WIE diese “geängstigten Angehörigen und Beschwerdeführer” heute über diese Tatsache nachdenken- sollten. Schließlich haben die ja, “treu wie sie sind”, heute sogar im Auto nebeneinander sitzend den Maulkorb auf oder liegen gar noch nebeneinander im Ehebett- MIT Maske! Oder? Wundern wurde es mich nicht ….

      Bin mir aber sicher, auch angesichts der “Sorge des Bill Gates …” (heute), das DENEN da was “rausgerutscht ist”, was nicht sein sollte. Könnte es passieren, das irgendwann “Verschwörungstheoretiker”, die als solche von Medien und Kritiklosen bezeichnet werden, tatsächlich “recht gehabt hätten”?

      Es wird spannend!

      Schön neugierig bleiben, Freunde!

      G. Käntzler

      1. Dass DENEN da was “rausgerutscht ist”, halte ich für sehr unwahrscheinlich. In der großen Politik geschieht nichts zufällig, ist alles mit big money “unterfüttert”.
        Andersherum wird ein Schuh draus: Es scheint mir kaum glaubhaft, dass gegen diesen Jahrtausendvirus von so vielen (zum Teil konkurrierenden) Pharmafirmen nahezu gleichzeitig der Heil bringende Impfstoff in so kurzer Zeit und mit etwa nur einem halben Jahr Vorlauf angekündigt(!!!) “entwickelt” wurde. Nein, sie hatten ihn schon längst in der Retorte …


        Zu letzterem: Volltreffer!
        Herzlich, Ped

  19. Durch “Alte Socke” auf dem Wikihausen-Blog bin ich auf folgenden Hammer gestoßen

    Ghebreyesus (Chef der WHO) bedroht in dem Video auf einer cDU/cSU-Veranstaltung im Mai 2019 (mit “Merkelchen”, “Volldrosten”, “Spahnferkel”, Geiz-Stiftung und who

    ()https://subscriptions.gir.st/watch?v=q8sBYFj5Rps

    ab ca. 1:57:00 die anwesenden Personen.

    Die Aussage, nachdem er einen Todesfall einer verantwortlichen Person im Kongo geschildert hat, nach einer demonstrativen Pause:

    “Danke. Danke. [für Applaus] Das war ein unglaublicher Mut – – – – [wirft besonders auffällig Blicke ins Publikum] gleichzeitig sehe ich zwar, dass Sie mutig sind, dass aber jeder einzelne von Ihnen gefährdet ist. Und zwar jeden Tag. Ihr Leben ist in Gefahr. [kehrt mit den Augen zu seinem Manuskript zurück] Zusätzlich zu den Angriffen kämpfen wir gegen Mythen, Falschinformationen, und die Politisierung des Ebola-Ausbruchs [im Kongo]. …”

    Was redet der Mann da? Zuerst spricht er vom Kampf gegen Ebola sowie dem gewaltsamen Tod eines Arztes. Er erhält Beifall vom Publikum … redet dann von “Mut” – der Bezug ist völlig unklar, wessen Mut, des Publikums? – und sagt dann mit besonderer Betonung und auffällig ins Publikum blickend:

    “gleichzeitig sehe ich zwar, dass Sie [eindeutig auf das Publikum bezogen!] mutig sind, dass aber jeder einzelne von Ihnen [im Publikum] gefährdet ist. Und zwar jeden Tag. Ihr [eindeutig auf das Publikum bezogen] Leben ist in Gefahr.”

    um dann wieder auf sein Thema zurückzukommen und wieder vom Kongo zu sprechen.

    Was war das?

    Haben vielleicht einige Leute im Publikum gleich oder auch erst später bemerkt, dass diese Drohung des W.H.O.-Chefs nicht dahergeredet war sondern mafiamäßig vollkommen ernst gemeint war?

    "Ihr Leben ist in Gefahr! Täglich!" [wenn Sie nicht mitmachen]

    1. Kommt mir vor wie ein Versicherungsvertreter. Die erzählen einem auch immer, dass man in Gefahr ist, wenn man keine Versicherung abschließt. Das ist eben Promotion am Limit!

      Dieses erbärmliche WHO-Würstchen!

      1. Nein, das kommt mir ganz anders vor: der Mann stößt versteckte Todesdrohungen gegen Politiker aus, falls sie nicht mitmachen. Es wäre interessant rückzuverfolgen, wen aus dem Publikum der Mann bei seinen Drohungen ganz genau und demonstrativ anblickte.

        Das ganze würde nicht so ablaufen, wenn nicht ganz konkret Personen Angst vor ganz realer (nicht eingebildeter) Bedrohung hätten: ich sage nur: Pharma-Mafia – und zwar nicht, um Mafia zu verharmlosen, sondern um die Kriminalität des Pharma-Moloches zu verdeutlichen: die schicken auch gedungene Mörder. Es geht schließlich um Milliarden-Gewinne. Das muss man sich einfach klar machen.

        1. Das BigPharma mit Mafiamethoden arbeitet, glaube ich auch.

          Ich glaube aber eher nicht, dass die versteckte Drohungen ausstoßen. Das würde doch immerhin das Risiko bergen, dass der Bedrohte zu dämlich ist, die versteckte Drohung zu erkennen und dann trotzdem das tut, was er auf keinen Fall soll.

          Ich glaube, wenn die schon drohen, dann unmissverständlich, eben weil es tatsächlich um sehr viel geht.

          Vielleicht habe ich aber auch zu viele Mafiafilme gesehen… 🙂

          1. Das mit den Drohungen ist ganz einfach: die versteckten Drohungen werden den Adressaten auch noch ganz klar ins Gesicht gesagt. Die Drohung bekommt damit eine ganz andere Dimension wenn der Betroffene merkt: “Oh scheiße, die schrecken nicht einmal vor der Aussprache in der Öffentlichkeit zurück!” Dass der Betroffene dämlich sein könnte, damit rechnen die bestimmt auch.

            Mal ein paar Hintergründe: der WHO-Chef war Gesundheitsminister in Äthiopien, einem Land, das wie viele Länder in Afrika von Korruption durchseucht ist. (Laut aktueller Liste CPI der Transparency int. auf Platz 96, in der Umgebung von Kosovo, Osttimor, Gambia, Kolumbien). Wer glaubt, dass dort in Äthiopien ein Lämmchen irgend einen Ministerposten innehaben wird, träumt. Und die Wahrscheinlichkeit, dass es ein moralischer Superheld macht, ist auch eher gering.

            Ghebreyesus ist seiner Rede nach sehr in der dem.REP.Kongo involviert. Angeblich wegen den dortigen Ebola-Ausbrüchen. Nun ist es nicht einfach zu ignorieren, dass im Kongo Vorwürfe erhoben werden, dass die Ebola-Ausbrüche durch die (oder einige der) dort aktiven Ärzteteams SELBST ausgelöst werden.

            Ich kann das nicht beurteilen. Aber Tatsache ist: der Kongo ist eines der reichsten Länder Afrikas durch die Bodenschätze – aber eines der ärmsten Länder durch die Verarmung und Verelendung der Bevölkerung. Wie geht das zusammen? Seit der belgischen grausamen Kolonialherrschaft wird das Land von ausländischen Kräften mit starken wirtschaftlichen Interessen gezielt destabilisiert. Die großen Konzerne, die dort das für die westliche Wirtschaft überlebensnotwendige Coltan abbauen lassen, sowie andere wichtige Bodenschätze, lassen das Land nicht zur Ruhe kommen. Indem Verbrecherclans finanziert werden kann sich kein stabiles System herausbilden, das die Konzerne in Gefahr brächten, ihre Macht und ihren Einfluss zu verlieren. Die Instabilität im Kongo liegt im Interesse des Westens und der Konzerne.

            Und in diesem Umfeld würde die W.H.O. angeblich selbstlos Wunder wirken wollen indem sie tatsächlich und nichts anderes als Ebola bekämpfen? Die Kongonesen würden angeblich ihnen helfende Ärzte auf Koordinationssitzungen (nicht im Feld) gezielt erschießen? Das glaube wer will. Und das Ghebreyesus ein Waisenknabe wäre, kann auch glauben wer will.

  20. Ich möchte hier noch einmal auf die im Video von der 36. Sitzung des Corona-Ausschusses gezeigten Bilder der Nebenwirkungen der aktuellen Corona-Impfung eingehen…

    () https://youtu.be/GyOrXnx5lUQ?t=1662

    wobei mir wichtig ist, dass das jeder vollständig nachvollziehen kann.

    Die Bilder zeigen, dass die betroffenen Menschen so gut wie keine Kontrolle mehr über die Steuerung ihre Muskulatur haben. Das deutet darauf hin, dass die durch die Corona-Impfung erzeugten Antigene, Nervenzellen im Gehirn angreifen, die für die Steuerung der Muskulatur zuständig sind.

    Vom Wirkmechanismus gleicht das der Entstehung der Narkolepsie, die durch den Pandemrix-Impfstoff der Fa. GlaxoSmithKline verursacht wurde, der 2009 während der Schweinegrippe-Kampagne massiv durch die alten Medien (MSM) beworben wurde. Es handelt sich dabei um eine Autoimmunerkrankung, deren Entstehung im folgenden Artikel beschrieben wird:

    https://www.zentrum-der-gesundheit.de/news/medizin/impfung-gegen-schweinegrippe-fordert-opfer-15000055

    Zitat aus dem Artikel: “Ein bestimmtes Protein-Stückchen des Grippevirus findet sich im Pandemrix-Impfstoff in höheren Konzentrationen als in den Konkurrenz-Impfstoffen. Der Körper der Geimpften bildet daraufhin Antikörper gegen dieses Virusstückchen. Klingt alles ganz normal und erwünscht. Denn die Impfung soll ja eine Antikörperbildung in die Wege leiten. Und die entstandenen Antikörper sollen das Grippevirus bekämpfen.

    Nun gibt es auf dem Virusstückchen aber bestimmte Strukturen, die es auch auf den Nervenzellen im Gehirn gibt – und zwar auf jenen Nervenzellen, die den Schlaf-Wach-Rhythmus regulieren. Also greifen die Antikörper nicht nur Grippeviren an, sondern auch die identischen Strukturen in den Nervenzellen – und führen somit zur Autoimmunerkrankung namens Narkolepsie.”

    Autoimmunerkrankungen sind die Folge einer Irritation des Immunsystems, die auch abseits von Impfungen, durch die Aufnahme von Schadstoffen (Atmung, Nahrung oder über die Haut) und/oder durch Stress entstehen können. Stets greift dabei das körpereigene Immunsystem Zellstrukturen des eigenen Körpers an.

    Schon bei der Entwicklung herkömmlicher Impfstoffe scheint es immer wieder dieses Probleme mit (u.U. tödlich verlaufenden) Autoimmunreaktionen zu geben, die man einfach nicht gelöst bekommt. Bei der sogenannten Corona-Impfung, die eigentlich keine Impfung, sondern ein genetischer Eingriff ist, kommt zu all dem noch das Risiko der Genmanipulation hinzu. Niemand weiß bis heute etwas über mögliche Langzeitschäden, weil es keine Versuche über längere Zeiträume (5 bis 10 Jahre) gegeben hat. Warum? Angeblich weil wegen der herbeifabulierten Gefährlichkeit von Corona keine Zeit dafür war. Tatsächlich ist es aber wohl eher so, dass die Pharmaindustrie keine 5 bis 10 Jahre warten wollte, bis man die Milliardengewinne aus dem Corona-Geschäft auf der Habenseite verbuchen konnte.


    Und dann war da ja noch die Geschichte mit den Nano-Partikeln – als Teil des Impfstoffes. Daraus entwickelte sich damals eine Diskussion um die Zweiklassen-Gesellschaft beim Impfen, weil nämlich Politiker und Sicherheitsapparat eine Variante des Impfstoffes erhielten, der ohne diese Nano-Partikel auskam. Als das bekannt wurde, schwand die Zustimmung zur Impfung in der breiten Bevölkerung rasant. Kurz danach wurde Entwarnung gegeben, das Virus wäre doch nicht so gefährlich und die nano-partikel-verseuchten Impfstoffe wurden entsorgt.
    Herzlich, Ped

  21. Betrug des stat. Bundesamtes bei Sterbezahlen für 2020:

    das stat. Bundesamt veröffentlicht gefälschte Todeszahlen für 2020.

    Es werden 5.327 Sterbefälle aus 2019 eingerechnet um auf eine Gesamtzahl für 2020 von 972.155 Tote zu kommen:

    https://reitschuster.de/post/pressemitteilung-statistisches-bundesamt/

    Vielleicht um näher an die 995.000 erwarteten Tote zu kommen? Siehe folgenden Artikel

    https://www.prof-mueller.net/
    dort Zwischenüberschrift: “Regierung rechnete mit erhöhter Sterblichkeit – auch ohne Corona!”

    Man kann bald nicht einmal mehr einer nackten Zahl der Regierung trauen.

    1. Dort aktuelle Entwicklung: Der Pressesprecher des stat. Bundesamtes hat sich in den Kommentaren zu Wort gemeldet. Auch Herr Prof. Müller machte einen Einwurf.

      Mein Resümee:

      _ Die Zahlen wurden vom Stat. Bundesamt korrekt (nach deren Definitionen) angegeben.

      _ Im Rahmen der aktuelle gesellschaftlich wichtigen Diskussionen sind sie aber irreführend und hätten einer genaueren Darstellung/besserer Erläuterungen bedurft.

      _ wenn man die demographischen Tatsachen und den allgemeinen Trend sowie den Wissensstand der Bundesregierung berücksichtigt ist für 2020 für niemanden Informierten eine besondere Übersterblichkeit erkennbar und damit auch nicht behauptbar

      _ Wo ist die tödliche, Gesundheitssysteme bedrohende, grassierende Seuche?

      https://reitschuster.de/post/pressemitteilung-statistisches-bundesamt/

  22. Kleines Schmankerl zum Abend, zum Thema:
    ()https://www.youtube.com/watch?v=8OU3riyOwEo

    Boris Reitschuster …. offener und ehrlicher Journalist!
    Nur- das Übliche. Korrekte Fragen werden nicht korrekt beantwortet! Wir erkennen ja auch mittlerweile “die Taktik”. Sehr deutlich. Alle “Befragten” winden sich und reden viel, ohne etwas zu sagen.
    Es ist bis zu diesen Schauspielern dieser bundesdeutschen “Ministerien” offensichtlich noch nicht durchgedrungen, das man auch lügt, wenn man “nichts sagt”. Da gilt nicht die juristische “Unschuldsvermutung”, nur mal als Hinweis.

    Guten Abend!

    1. Aber immer aufpassen. Der Tilo Jung war auch mal “ein Guter” und ist inzwischen völlig rumgedreht – bei Boris ging es zwar bisher andersrum – kann sich aber auch wieder jederzeit ändern.

      Ein ganz anderes Beispiel ist der Monitor-Restle: so ein Mainstream-pseudokritischer Aushänge-“Journalist” war nie anders. genauso der Prantl. Wer auf solche Leute was gibt, ist schon verloren.

      1. Albrecht! Sie haben recht! (Darf ich das “Du” anbieten?)
        Tilo Jung, “Jung & Naiv”…, das WAR die kritische Stimme. WAR! Von Beitrag zu Beitrag konnte der Aufmerksame gut erkennen, “wie er sich wandelte”. Leider.
        Da ich mich, sicher ebenso Sie, zu “den Aufmerksamen” zähle, bleibe ich schön vorsichtig und kritisch.
        Übrigens: Eine gleiche Metarmophose macht derzeit “Pegida” und Bachmann durch.
        Aber tut nichts zur Sache… über früher oder später knicken alle ein. Auch Beispiel “Dr. Schiffmann”- und wie sie alle heißen.
        Wir leben damit. Leider.

        Best regards!

        Gerhard

        1. Herr Känzler, Ihre Aussage “früher oder später knicken alle ein” würde ich nur teilweise unterschreiben. Viele, aber nicht alle. Aber man muss immer wachsam sein, in der Tat.
          Was mich im Speziellen beschäftigt, und vielleicht gibt es ja Meinungen aus dem Forum dazu:
          – Viele Menschen haben im Zuge dieser Krise einen Erkenntnissprung gemacht (manche natürlich auch schon früher oder schon immer), der ihnen das Manipulationsgebilde und die dahinterstehenden Absichten klarwerden ließ
          – Wir (QD) sind der Meinung, dass sich dieser Erkenntnissprung nicht wieder revideren läßt
          – Diese Tatsache muss auch den Manipulatoren bewusst sein
          – Dies bedeutet, dass die Manipulatoren gegen diesen Mechanismus eine Psychostrategie entwickeln bzw. entwickelt haben
          – In der Tat beobachte ich traurigerweise wie – selten – Einzelpersonen, die diesen Erkenntnissprung hatten, wieder “rückfällig” werden
          – Häufiger anzutreffen ist eine derartige Rückorientierung bei Personen des öffentlichen Interesses, Medienschaffenden und Politikern
          – Die Psychostrategie und teilweise auch recht handfeste Strategie, wie man Personen des öffentlichen Interesses wieder auf Linie bekommt, ist uns relativ klar
          – Aber welche Psychostrategie wird gegen Normalo-Querdenker gefahren, um ihn wieder in die Schafherde einzugliedern? Gibt es hierzu Ideen?

          Beste Grüße

          1. “Aber welche Psychostrategie wird gegen Normalo-Querdenker gefahren, um ihn wieder in die Schafherde einzugliedern? Gibt es hierzu Ideen?”

            Pseudo-Ottonormalverbraucher-“Meinungen” in Foren und Blogs sind das wesentliche Mittel!

            Die Taktik besteht darin, in allen Ecken des gesellschaftlichen Diskurs das Hauptmedien- und Politk-Narrativ als sagbar und beachtenswert einzuführen.

            Man mache sich mal klar: eine Pressure Group könnte durchsetzen, dass in jedem Diskurs, in jeder Talkrunde, in jedem Forum, in jedem Kanal, die Behauptung von scheinbar eigenständigen, scheinbar unabhängigen Personen die Behauptung vertreten werden könnte, dass die Erde eine Scheibe wäre. Wo führe das hin? Genau dahin wo wir jetzt mit dem Corowahn sind: die Mehrheit denkt “Ja, vielleicht ist ja irgendwas dran!”

            Und genau damit wird jeder Fortschritt in der Erkenntnis verhindert. Denn diese Agenten und PR-Büttel bringen ihre Behauptungen immer und immer wieder, völlig unberührt von JEGLICHER WIDERLEGUNG. Weil es Einfluss-Agenten sind und sie damit ihr Geld verdienen. Auf diese Weise wird der Wahn am Laufen gehalten – entgegen jeder Evidenz und Tatsache.

            Die Taktiken in den Foren sind sehr unterschiedliche. Da schleimen sich auch Leute ein mit scheinbar kritischen Aussagen – um dann “völlig schwerelos” immer wieder Mainstream-Narrative und Trigger-Wörter und längst widerlegte Behauptungen einzuführen. Es gäbe ja eine Seuche, das Virus wäre ja schon besonder gefährlich, alle Staaten der Welt könnten doch nicht gleichgeschaltet sein, so viel Wissenschaftler könnten doch nicht ganz falsch liegen, …

          2. ” … alle Staaten der Welt könnten doch nicht gleichgeschaltet sein, so viel Wissenschaftler könnten doch nicht ganz falsch liegen, …”…

            Ja, Albrecht, diese Frage ist wohl SEHR berechtigt!
            Mir drängt sich der Eindruck auf, das es von nicht so weit hergeholt sein kann, wenn “Verschwörungstheoretiker” von “der Weltregierung” sprechen und schreiben.
            Auch die alljährlichen “Bilderberger- Konferenzen” (u.A. mit Herrn/ Frau Spahn 2017, USA) sind nur von Idioten als “Internationales Kaffee- Kränzchen” einzurahmen… äh, zu verstehen..

            Hinzu kommt die Tatsache, das erst kürzlich im “ntv- Laufband” die Nachricht kam, das “… Herr Soros (!) darüber besorgt sei, das zu wenig für die Eindämmung der Pandemie getan werde…”.
            Also, wer jetzt die Nachtigall nicht trampeln hört, an dem sind “alle Einschläge vorbeigegangen und er hat nix gehört …”!

            Fazit:
            Alle “Verschwörungstheorien” bergen entweder die ganze Wahrheit- oder nur ein Fünkchen. Es bleibt sich egal, wie jeder damit umgeht. Fakt ist jedenfalls, das alles “von Langer Hand” geplant war und ist. Genau so verhält es sich mit der “plötzlich erkannten und ausgerufenen ‘Pandemie’ und den “erst jetzt zu erfindenden ‘Impfstoffen’…”. Und dann der Hickhack um die “Zulassungen”- dann “die eingeschränkte Wirksamkeit”. Dazu die Verdunkelung zu bisherigen Impfschädigungen … OHNE CovSARS!!!

            So gebe ich @ Dian C. nur allzu gern recht, das DIE die Blaupause dazu schon lange in der Schublade hatten.
            Aber eine Frage bleibt:
            WARUM, in Drei Teufels Namen, setzen die alles daran, den “Zeugen Jehofas” und den strenggläubigen Juden (nicht abwertend!) ihre These vom “Jüngsten Gericht” und “dem Weltuntergang” oder der “Rückkehr des Messias” Bestätigung zukommen zu lassen?
            Schaut man nach Israel… da geht die Post ab! MAN versteckt diese Tatsachen (der gewaltsamen Proteste der Ultra- Orhtodoxen) hinter der Million “erfolgreich Geimpfter”. Dabei wird verschleiert, das es bisher ÜBER 600 (!) nach der Impfung Geschädigter gibt. Aller Altersgruppen- oft OHNE Vorschädigungen!

            Wer DAS unverschwurbelt schlüssig beantworten kann, den erkläre ich zum “King der Foren”!!!!

            Herzlichst
            G. Käntzler

          3. zu G. Käntzler sagt:
            30. Januar 2021 um 17:48 Uhr

            Soros wird immer noch künstlich am Leben gehalten? Was sie diesem Zombie wohl injizieren?

            Und ein Tipp: schauen Sie nicht ntv oder hören/sehen überhaupt Pseudo-Nachrichten. Wir neigen dazu, trotz größter Skepsis dem Framing, der Themenfokussierung und maskierten Lügen aufzusitzen.

      2. im Moment setzt er sich ja an mit Lieschen Neubauer an die die Spitze jener Gruppierung die den totalen Lockdown will, Der Häuptling der Morgenthau-Jakobiner. Der Umstand, dass dieser Vogel bei der “Studienstiftung des Deutschen Volkes” die Stipendiaten ausucht, zeigt wie kaputt dieses Land ist.

    1. Thomas Röper kämpft mit den Nachwehen einer Migration.
      Ist mir wohlbekannt. Stammleser erinnern sich vielleicht noch an das Frühjahr 2019. Bei so etwas – auch noch als Ein-Mann-Unternehmung – kann so einiges schief gehen.
      Also: so wie es derzeit aussieht, nix mit Zensur oder DNS-Abschaltung oder, oder, oder. Runter mit dem Blutdruck.
      Herzlich, Ped
      PS: Muss mich korrigieren, die Migration ist genau zwei Jahre her. Hoffen wir mal, dass es nur eine Überlastung des Servers ist (so wie im Herbst des vergangenen Jahres).

      1. Also bei mir läuft Anti-Spiegel.

        Allerdings dauert der Seitenaufbau seit gefühlt 2 Wochen ein wenig länger als gewohnt.
        Geduld kurz, dann ist Thomas Röper wie gewohnt da. 😉

        Denke, in St. Petersburg sind die Server nicht so schnell, oder die EU Grenzkontrollen von Datensätzen verursachen es, da über die NSA Server umgeleitet werden muss. 🙂

        1. Also bei mir kommt die Seite noch nicht ….


          Aus Thomas Röpers Seite:

          !In eigener Sache – Technische Probleme (hoffentlich) behoben
          Der Anti-Spiegel war in letzter Zeit überlastet, er hat lange geladen und manchmal Fehlermeldungen gezeigt. Wir hoffen, dass das Problem jetzt nach einen Serverwechsel behoben ist. Da es einige Zeit dauert, bis alle Namensserver dieser Welt die neuen Informationen upgedatet haben, kann es aber noch hier und da zu Problemen kommen. Bei der Gelegenheit weise …”

          Also noch etwas Geduld 😉
          Herzlich, Ped

          1. Jetzt isser da … geht auch, wenn man nur Script für die Seite an sich zulässt, den Rest kann man blockiert halten …

      2. Wie es aussieht ist der Anti-Spiegel von Thomas Röper abgeschaltet. Auch heute morgen um 5:50 h war der Server nicht erreichbar.

        Letzte Meldungen von Thomas Röper findet man auf facebook, darunter auch diese hier von 27.01.2021 um 11:52 h:

        “In den Niederlanden finden seit fast drei Tagen massive Unruhen im ganzen Land statt. Die Lage ist außer Kontrolle, aber die deutschen Medien berichten gar nicht oder nur sehr verhalten.”

        Eine Suche nach “Unruhen in den Niederlanden” liefert übrigens jede Menge Zündstoff.

        Nachtrag, 7:05 Uhr: Der Anti Spiegel ist wieder online…

    2. ANtispiegel hat schon immer eine wie ich finde unangenehme Masse an Skripten (oder was das ist) laufen. Oft dauerte es elendslange, bis die Seite aufgebaut wird. In manchen Browsern kann man unten in der Statuszeile mitlesen, was da alles aufgerufen wird: ich finde, viel zu viel. Tracking und son Schrott

      Aber aktuell kommt das “In eigener Sache – Technische Probleme (hoffentlich) behoben”

  23. Bei der Gelegenheit, und weil die ALTEN deutsche Medien nicht darüber berichten, hier ein Hinweis auf einen Artikel beim Anti-Spiegel:

    Thomas Röper hat mangels deutscher Artikel, einen russischen Bericht übersetzt, der die Situation in den Niederlanden wiedergibt:

    “Drei Nächte Aufstände: Die Niederländer antworten mit einem Tsunami aus Pogromen auf den Lockdown

    Die niederländische Regierung wird die aufgrund der Pandemie verhängte Ausgangssperre wegen der Unruhen im Land nicht aufheben. Die ersten Gerichtsverhandlungen gegen die Auftständischen beginnen am 27. Januar. Nach Angaben des Justizministeriums drohen ihnen Haftstrafen. Die Zahl der Inhaftierten geht in die Hunderte. Und das ist offenbar nicht das Ende. Aggressive Jugendliche veranstalten seit mehr als zwei Tagen Pogrome. In Amsterdam sprengten Demonstranten sogar eine Fußgängerbrücke in die Luft. …

    … Gleichzeitig gibt es keine Maskenpflicht auf der Straße, fast niemand trägt eine. Aber Schulen, Universitäten, Kindergärten sind geschlossen, Museen, Zoos, Turnhallen, Schwimmbäder, Friseure, Schönheitssalons, Restaurants und Bars sind geschlossen, geschlossen sind auch alle Geschäfte außer Lebensmittelgeschäften. Gearbeitet wird von zu Hause. Der letzte Tropfen (der das Fass zum überlaufen brachte) war für die jungen Menschen übrigens die zum ersten Mal seit dem Zweiten Weltkrieg verhängte Ausgangssperre. ”

    Mehr lesen…

    https://www.anti-spiegel.ru/2021/massive-unruhen-in-den-niederlanden-bilder-die-deutsche-nachrichten-nicht-zeigen/

    1. “Pogrom” sind die nicht ganz gesund. Und gleich noch ein Tsunami davon? Entweder hat die Übersetzung durchgedreht, oder die Ruskies spinnen inzwischen auch komplett …

      “Pogrom steht für die gewaltsame Ausschreitung gegen Menschen, die entweder einer abgrenzbaren gesellschaftlichen Gruppe angehören oder aber von den Tätern einer realen bzw. vermeintlichen gesellschaftlichen Gruppe zugeordnet werden.”

      Oder soll ab jetzt jede Demo mit Ausschreitungen als “Pogrom gegen Polizisten” geltend gemacht werden?

      1. Tja, die Fragen kann wohl nur Thomas Röper abschließend beantworten. Ich nehme an, dass da mit der Übersetzung was schief gelaufen ist.

        Ich würe das jetzt nicht so hoch hängen, Thomas Röper leistet ansonsten hervorragende Arbeit.

  24. Nein. Leider nicht. Das als vertraulich eingestufte Papier wäre von Mutigmacher e.V. veröffentlicht worden, die aber dann zur Entfernung gezwungen worden seien.

    Interessant was unsere “Qualitätspresse” damals daraus machte: das glatte Gegenteil des Inhalts wurde behauptet https://www.mdr.de/nachrichten/politik/inland/bka-warnt-vor-uebergriffen-von-radikalen-querdenkern-100.html

    dagegen zB https://www.epochtimes.de/politik/deutschland/durchgesickerter-bka-bericht-reale-gewalt-geht-von-links-aus-medien-berichten-gefahr-von-rechts-a3403982.html

    Ich denke, es wird sich doch in all den Fällen um das gleiche Papier gehandelt haben. Hier ausführlicher der aktuelle Stand zur Sache:

    https://reitschuster.de/post/corona-proteste-hauptsache-extremistisch/

    1. Eigentlich ist die Zyklenzahl nur eine Rand-Vorgabe für die Testausführung. problematisch wird es erst wenn die Zyklenzahl zur Bewertung des Testergebnisses herangezogen wird.

      Man muss dazu verstehen, dass praktisch während dem Zyklieren gleichzeitig auch die Detektion läuft. Es kann nun also sein, dass ein Test über 45 Zyklen läuft, aber schon nach zB 27 Zyklen das Detektionssignal den eingestellten Schwellenwert überschritten hat.

      Es könnte sogar durchaus Sinn machen, den Test regelmäßig 45 Zyklen laufen zu lassen, weil man vielleicht aus dem Signal nach dem ersten Überschreiten des Schwellenwertes noch Informationen ziehen könnte. Es wird ja eine kontinuierliche Größe aufgezeichnet, zB die Stärke einer Lumineszenz. Diese Lumineszenz muss nicht kontinuierlich stetig oder monoton zunehmen.

      Das Problem ensteht genau dann, wenn JEDES Überschreiten des Signals über den vordefinierten Schwellenwert BIS HIN zum 45. Zykles als “positiv” gewertet wird. Genau damit wird der Test zum Witz.

      Daher auch die Forderung mancher Stellen, mit dem Test-Ergebnis auch die Zyklenanzahl ab der das Signal den Schwellenwert überschritten hat, anzugeben. Daraus könnten genau die Informationen gewonnen werden: wie viele der positiven Testergebnisse sind wirklich glaubwürdig. (entsprechende Auswertungen wurden in den USA gemacht und festgestellt, dass nur die positiven Tests mit ganz niedrigen Zyklen bis zur Schwellenwert-Überschreitung tatsächlich auf Erkrankungen hindeuten)

      Wir haben ein Versagen der Wissenschaft auf der ganzen Linie, da diese Tatsachen der Politik nicht knallhart und unausweichbar vermittelt wurden.

      Und es ist genau dort das Versagen von “Wiesel-Wieler” und “Volldrosten” zu verorten: offensichtlich informieren sie die Politik falsch indem sie diese nicht über dieses Grundmissverständnis unmissverständlich aufklären.

  25. Entscheidung eines Bundesrichters in den USA, daraus:

    “In der Tat können die größten Bedrohungen für unser System der verfassungsmäßigen Freiheiten entstehen, wenn die Ziele lobenswert sind und die Absicht gut – vor allem in einer Zeit des Notstands.“”

    In der Tat. Genau das ist auch mein Punkt: was ist eine Demokratie denn Wert, wenn mit ausreichender krimineller Energie und viel, viel Personal und Geld nach Belieben ein Notstand ausgerufen werden kann um damit alle Grundrechte zur Disposition zu stellen?

    Eine Demokratie und Notstandsgesetze sind grundsätzlich unvereinbar miteinander!

    https://tkp.at/2021/01/29/bundesrichter-im-us-bundesstaat-pennsylvania-erklaert-lockdown-fuer-verfassungswidrig/

    Die oftmals geführte Diskussion, ob nun der Notstand (Corona) nun groß genug sein oder nicht, um Notstandsgesetze (Aushebelung von Grundrechten!) anwenden zu können oder nicht, ist an sich schon eine Verengung des Diskurskorridors. Demokratie und Notstandsgesetze sind nämlich schlicht unvereinbar da damit ständig ein riesiges Scheunentor zur Diktatur offen gehalten wird.

    Grundrechte können und dürfen überhaupt nie zur Disposition gestellt werden!

  26. Eine positive Nachricht: Der Europarat (das ist nicht die EU!) verabschiedete am 27.1.2021 eine Resolution, in welcher unter Punkt 7.3 ff aufgeführt wird, daß auf nichtgeimpfte Personen keinerlei mittelbarer oder unmittelbarer Druck ausgeübt werden darf und daß diese zudem in keiner Weise diskriminiert werden dürfen, weder am Arbeitsplatz noch beim Reisen etc.. Die Resolution ist nach Rechtsanwalt Ralf Ludwig rechtsverbindlich für alle 47 Mitgliedsstaaten des Rates, auf sie kann sich jeder berufen, ob vor dem Arbeitgeber oder vor Gericht:
    https://pace.coe.int/en/files/29004/html

  27. Diese Ausgabe des “Talk im Hangar 7” kann ich wieder voll empfehlen:

    hier entlarvt sich ein Trans- und Antihumanist durch Ausbreiten seiner ganzen Irrsinnswelt, seiner ganzen arroganten Sichüberalle-Stellen, die ganze Elite-Arroganz quillt aus dem Bildschirm.

    Nicht unerwähnt bleiben soll der Licht blick Frau Guerot.

    https://youtu.be/UYvf6rHovKQ

    “Corona-Haft ohne Ende: Unterordnen oder Aufbegehren?”

    1. Es ist tatsächlich wohltuend, den Ausführungen der Politikwissenschaftlerin Ulrike Guerot zuzuhören. Allerdings ist mir der Preis zu hoch, wenn man sich dazu auch noch den an lauterbach erinnernden Pharma-Lobbyisten und Dummschwätzer richard greil anhören muss.

      Läuft das im österreichischen Fernsehen?

      Immerhin wäre es ein Lichtblick, wenn Leute wie Ulrike Guerot zu einer Talkshow im österreichischen Fernsehen eingeladen würden.

      1. Wie peinlich:

        “Richard Greil maturierte am Akademischen Gymnasium Salzburg mit ausgezeichnetem Erfolg.”

        Aha. Da weiß man, was man hat. Danke Wikiblödia.

  28. Der sonst wunderbare Text enthält, wie mir scheint, einen Flüchtigkeitsfehler. “Bei der Polymerase ist die exponentielle Vermehrung real und gewollt, und da der Exponent den Wert zwei hat…”
    Mir scheint, es handelt sich um eine Funktion der Form y = 2^x, wobei x die Anzahl der Verdopplungen und y die Anzahl der nach x-facher Verdopplung vorhandenen Sequenzen ist. 2 ist also Basis der Potenz.


    Da haben Sie völlig recht, danke!
    Schließlich ist 24 hoch 2 etwas völlig anderes als 2 hoch 24 (als Beispiel im Artikel).
    Ich kümmere mich gleich um die Korrektur.
    Herzlich, Ped

    1. Dazu auch ein kleiner, wichtiger Hinweis von mir:

      In der Natur gibt es keine exponentielle Vermehrung ÜBER DIE ZEIT.

      Das liegt einfach an der Tatsache, dass Ressourcen immer begrenzt sind und Nachlieferung aus immer größeren Entfernungen immer eine ansteigende Verzögerung bewirken (zB “logistische Funktion”). Von daher gibt es zB keine exponentielle Verbreitung von Viren, da die “Nachlieferung von Wirten” begrenzend wirkt (immer mehr Immune in der direkten Umgebung, immer größere Distanz zu weiteren potentiellen Wirten, ua auch durch (Selbst-)Isolation Kranker, und bitte, asymptomatische Infizierte gibt es nicht! Eine der phantastischsten Lügen des Corowahns.).

      Das widerspricht nicht der Tatsache, dass es in der Natur exponentielle Vermehrung in Schritten geben kann, wie in dem hier gegebene Beispiel. Insbesondere, da dort durch spezielle Versuchsbedingungen (aktive Durchmischung, Überangebot an Grundmaterial, …) die Annäherung an eine exponentielle Vermehrung erzielt wird, der Vorgang soll schließlich möglicht schnell vonstatten gehen.

      Aber bitte festhalten: eine exponentielle Vermehrung ÜBER DIE ZEIT (also in einer Funktion mit einer Zeit-Achse) tritt in der Realität nirgends auf, da rein physisch unmöglich.

      1. Um das vielleicht bildlicher zu machen, das Schach-Gleichnis:

        wenn man auf das erste Feld ein Reiskorn legt, auf das Zweite 2, auf das Dritte 4, auf das Vierte 8, … so ist das ein exponentielles Wachstum in Schritten. Anfänglich lässt sich das auch zeitlich exponentiell bewerkstelligen indem ich für das erste Feld 1 Sekunde benötige, für das zweite Feld auch, für das dritte Feld auch, … aber sobald man auf ein Feld 1024, oder gar 2^20 Reiskörner legen muss, geht das nicht mehr in 1 Sekunde. Zwar verdoppelt sich die Menge pro Schritt = exponentielles Wachstum, aber im zeitlichen Verlauf ist das nicht mehr so zu schaffen, dass die Funktion exponentiell wäre.

        Hier mit Euromünzen: http://www.brefeld.homepage.t-online.de/exponentialfunktion.html

  29. Interessant. Einige dieser mir immer schon verdächtigen Ansätze finde ich hier bei manchen Forenten wieder:

    “Nur allzu vertraut klingt auch die folgende Beschreibung: LaVay „forderte den Satanisten auf, sein eigener Gott zu sein, die eigene Macht nicht länger nach außen abzugeben und die Verantwortung für das eigene Leben in vollem Umfang zu übernehmen“. Wir finden dergleichen sehr häufig in der Selbstermächtigungs- und Selbstoptimierungs-Esoterik.”

    “Der schwache Mensch findet darin einen Vorwand, „die Verantwortung an andere abzugeben oder die Schuld bei anderen zu suchen, wenn etwas in seinem Leben nicht funktioniert. Die Ablehnung dieser infantilen Verhaltensmuster, die von einer unreifen Persönlichkeit und Opfermentalität zeugen, ist ein wichtiger Teil dessen, was einen Satanisten von anderen Menschen unterscheidet. ”

    “Wir kennen übrigens einen Begriff wie „Opferbewusstsein“ ebenfalls aus der esoterischen Ratgeberliteratur.”

    Sehr spannend:

    https://www.rubikon.news/artikel/die-satanismus-formel

  30. Lieber Ped,
    in der Voransicht musste ich feststellen, dass die Formatierung nach dem Absenden nicht mehr vorhanden war. Daher stelle ich den Kommentar erneut ein. Wenn jetzt ebenfalls die Formatierung verloren gegangen ist, löschen Sie bitte einen der beiden Kommentare. Wenn jedoch jetzt die Formatierung (mit Freizeilen) erhalten geblieben sein sollte, löschen Sie bitte den zuerst eingestellten Kommentar.

    Herzliche Grüße
    Ihr Felix

    Vielen Dank für diesen äußerst wichtigen und detaillierten Beitrag. Ohne mir genauere Kenntnisse über die technischen Details des PCR-Betrugs aneignen zu müssen , drängte sich mir einen Tag nach dem Lesen des Artikels folgendes Szenario – ein Verdachtsmoment – ins Bewusstsein, wobei die Abläufe aus der Sicht der Mächtigen geschildert sind:

    Ich möchte das Ziel der totalen Kontrolle voranbringen und vielleicht endlich umsetzen. Mit der Herangehensweise einer FMEA könnte es folgendermaßen aussehen:

    Was möchte ich erreichen bzw. was soll erfolgen?
    -> Ein riesiger Schritt in Richtung der totalen Kontrolle oder sogar die Erreichung dieses meines Endsieges.

    Was soll nicht erfolgen?
    -> Ein vorzeitiger Ausbruch der Leute auf dem Weg in die totale Kontrolle, kritisches Denken, Eigenständigkeit, Selbstverwaltung, etc. – kurzum: Es muss verhindert werden, dass eine zunehmende Anzahl von Menschen sich der Unterdrückung bewusst wird und dadurch weitere “Abtrünnige” generiert.

    Wie kann ich dieses Ausbrechen verhindern?
    -> Durch eine Desorientierungs- und Angstkampagne globalen Ausmaßes.

    Was soll die Basis sein?
    -> Ein Phantomerreger, der nicht nachweisbar sein wird – siehe Artikel!

    Was würde die Angstkampagne sofort zum Kollabieren bringen?
    -> Ein nachweisbarer Erreger, der genaustens analysiert werden kann.

    Wie verhindere ich die fachlich korrekte Analyse des Probenmaterials?
    -> Indem ich alle Bausteine soweit desintegriere bis eine beliebige Auslegung möglich ist.

    Zur Einschätzung dieser Vorgehensweise: Das ist sogar um Längen besser, als keinen Erreger finden zu können und die Menschen damit hinzuhalten.

    Was aber soll mit PCR vertuscht werden?

    Soll vertuscht werden, dass entweder nichts nachweisbares vorliegt oder dass eine andere Ursache der Auslöser – der Trigger – ist, so dass dann wiederum die ganzen in der Umwelt vorhandenen Schadstoffe ihre destruktive Wirkung entfalten können.

    Und jetzt noch eine sich aus dem Artikel ableitende Frage im Bezug auf den nicht isolierten Erreger:

    Was haben die Mächtigen/Philanthropen/Eugeniker in ihren Euthanasieimpfstoffen zusammen gerührt? Was für Programmcode wird den/uns Versuchskaninchen injiziert? Oder geht es nur um die Verabreichung des Zusatzstoffes PEG, so dass die Entzündungswerte im Körper ansteigen und total entgleisen? Wurde in der Vergangenheit zu Versuchszwecken nur Nanomaterial PEG injiziert, um die allein dadurch verursachten Schädigungen ermitteln zu können? Wie waren die körperlichen Reaktionen/Ausfälle? Der Vergleich mit makroskopisch im Cremes etc. enthaltenem PEG ist n.m.M. schlicht falsch, denn im Größenbereich nano hat voraussichtlich jeder Stoff andere Auswirkungen im Vergleich zu seiner makroskopischen Ausführung.

    Wenn es jetzt zu einer Übersterblichkeit kommt, dann wurde diese n.m.M. von den Drahtziehern der “Pandemiekrise” über die Euthanasieimpfung verursacht.

    1. @Felix,

      sehr gute Fragen und sehr gute Ansätze.
      Wir alle sind ja immer geneigt Antworten zu suchen und zu finden auf Fragen, die wir uns nicht richtig stellen.

      Und genau da ist der Knackpunkt. Falsche Frage führt zwangsläufig zur falschen Antwort.
      Die richtigen Fragen führen zur richtigen Antwort.
      Also kommt es nie auf die Antworten an, sondern nur auf die richtigen Fragen, die uns einer Antwort zuführen und somit auch nur dann zum richtigen Entscheiden und Handeln.

      Alle Fragen kann ich nicht beantworten, aber die Eine oder Andere schon, zumindest aber Hinweise geben.

      Zum PEG als Nanolipidhülle: Meines Wissen nach ist das der im Moment einzig offiziell bestehende Stoff- am Risikoärmsten- der klein genug ist und durch die Zellhembran hindurch aufgenommen werden kann, um so die mRNA in die Zelle zu integrieren. RNA alleine kann das nicht und würde durch die eigene Immunabwehr sofort zerstört werden. Für diesen genetischen Eingriff ist die Hülle erforderlich. Bisher ist es wohl der Wissenschaft noch nicht gelungen einen unbedenklicheren Stoff künstlich in der Form zu entwickeln. Ich weiß nicht, ob es Ziel und Absicht ist, durch die PEG Nanopartikel zu schädigen.
      Bekannt ist schon bald 20 Jahre, dass diese schädlich sind und auch schwere allergische Reaktionen hervorrufen können.
      Sekundär betrachtet bleibt das PEG Partikel aber in der Zelle und wirkt dort zur Anregung von Botenstoffen aus der Zelle heraus. Das kann zur Folge haben, degeneriert die Zelle zur Krebszelle, wird dieser nicht mehr als solche von der Immunabwehr erkannt und wird sich als Krebszelle vermehren.
      Weiterer Nachteil, PEG Nanopartikel sind in der Lage die Blut-Hirn-Schranke zu überwinden und können somit auch in Nervenzellen gelangen.
      Es gibt im übrigen zwei sehr sehr gute YouTube Vorträge von Frau Dr. Vanessa Schmidt-Krüger, Zellbiologin, die die Funktion so genannter “mRNA Impfungen” und die gesamten Risiken und Nebenwirkungen aufzeigt.
      Einfach mal den Namen dort über Suche eingeben.
      Das alles ist schon schlimm genug, aber das Problem ist der genetische Eingriff in die Zelle durch die RNA Sequenz in der Folge.
      Aus meiner Sicht ist die “Pandemie und Corona” und der jetztige Impfstoff, BNT 162 b2, nur Mittel zum Zweck, um die Menschheit auf weitere Impfungen einzuschwören und vorzubereiten.
      Diese werden nichts mehr mit Impfungen zu tun haben, sondern in Folge wird man den Menschen humangenetisch direkt verändern und dann im menschlichen Genom, also unsere DNA eingreifen und diese verändern.
      Also nicht nur Transhumanismus im technischen Sinne Mensch-Maschine nach Klausi Schwab, sondern echter Transhumanismus durch Genveränderung und -manipulation zu was auch immer. Menschen werden das nicht mehr sein. Ich kann das dann nur noch als ethisch-moralischen Holocaust an der gesamten Menschheit bezeichnen, käme das soweit.
      BionTech entwickelt gerade einen weiteren “Impfstoff” und erprobt diesen auch schon an Probanden-versteckt hinter der bedingten Zulassung des jetzigen Impfstoffes- mit der Bezeichnung BNT 162 c2, der das Ziel hat, genetische Defekte zu korrigieren.
      Nun ja, dann ist es ja nicht mehr weit zum Supersoldaten oder ähnliches, mit viel Kraft, wenig Hirn und ohne selbständigen Denken.
      Auch dazu kann man bei Markus Fiedler und dem Portal ” Wikihausen” ein sehr einschlägiges Recherche Video betrachten, die dieses Ansinnen der Pharmaindustrie verfolgen.

      Sonst aber waren wie gesagt Ihre vielen Fragen und die darauf selbst gegebenen Antworten sehr treffend.

      In dem Sinne, passt auf Euch auf und wenn es geht, schützt jeden, den ihr zum Selbstschutz ermutigen könnt.

      Gruß Tommi

      1. Lieber Tommi,

        herzlichen Dank für Ihre klasse Antwort! Da Corona ja leider von der Masse geschluckt wurde, versuche ich die weiteren Schritte der Mächtigen zu erahnen. Erst kürzlich hatte mich eine Bekannte auf die Georgia-Guidestones aufmerksam gemacht. Wenn Sie möchten, es gibt erstaunlicherweise eine offizielle Beschreibung vom damals ausführenden Granitwerk – Elberton Granite:
        https://www.wired.com/wp-content/uploads/archive/images/multimedia/magazine/1705/Wired_May_2009_Georgia_Guidestones.pdf
        Besonders fällt mir aktuell immer wieder der Punkt 7 der “Empfehlungen” auf:
        “7. Avoid petty laws and useless officials.” – “Vermeide belanglose Gesetze und unnütze Beamte.”
        Wenn das Ziel der Mächtigen erreicht sein wird, werden die willfährigen Vollstrecker sehr wahrscheinlich ebenfalls entsorgt. Wer hält sich gern eine Prätorianergarde, die den Boss jederzeit beseitigen kann? Anscheinend ist dies den ganzen Beamten noch gar nicht bewusst geworden!? Industrie 4.0 zur Abschaffung der lästigen Belegschaften der Betriebe. Was braucht dann noch jemand den Wasserkopf an Staatsverwaltung?

        Alles Gute und viele Grüße
        Felix


        Was die Geogia Guidestones betrifft, kann man da sehr schön die eigene oder übernommene Hypothese hinein interpretieren. Symbolik ist auch eine Frage der inneren Sicht, sie kann beliebig Objekten übergestülpt, ja diese auch ihrer ursprünglich gedachten Symbolik beraubt werden. Rasch läuft man hier in einen Bestätigungsfehler (Confirmation Bias) und entfernt sich von der Realität.
        Ich halte das nicht für zielführend, und es lenkt – unbewusst oder gewollt – ab vom Thema, dass wir allesamt ins Handeln kommen dürfen. Das sehe ich bei einem Großteil der sich als “aufgewacht” Ansehenden nur rudimentär oder auch gar nicht ausgeprägt.
        Freundliche Grüße, Ped

Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert.